SimpleSearch - Line and FST details


Line specific information

 
Line ID 504C02
Vector Used pAC161
Line Availability only available from NASC (N448314)
Segregation Analysis 50:21:16
Confirmed for Hit At1g77300
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g77300

 
Sequence (A. th genome BLAST matches underlined)
>11-K019705-022-504-C02-8409
TGGGATCCTCCCTATAGTGAGATACCTTTGTAACGCCTTCTCCCTCTCGGACATGAGATC
CGATCCATCATAATCCCCTCTTATATCGATGGATTTTTGTCCCGGAACGAGGAATAGGCA
CAAGTTTCTCTGCAGGAGATGACTCACACCGTGTCACGCAGTGCTAACTAAATCCGCTTA
TCTATATCAAATTGTTTATTTTGCTTCTGATTATACGATGTCTCAATCTTTCTCCAGATC
TGCTGCTTGAAACCTGTTCGATCAACAATACTATGGGATCCTGCCTATAGTGAGATCTCA
TTGAAGTAACTCACGTTTCCCATGGACGATGAACACGCTCTTACGTTTCTCGTAACAAAA
AACTCACCATGAGACACTGGCGGTAGATGCGGAAATGAATAGAACGGGATGCCAGGAGCA
ACAGACCAGGTGGTCGGATCCTCTTTGCCAGGTGAACCAGATTGATGAACAATGCTAAGT
GGAATCCCATAGGAAACTGGTAAGCGAGAAAGGAACTTTTGTTGCGGCTGTGCAGTAATT
GCATCACGCACATCTGTGCAGGGTGATGAATACCCGGCTGGAAGGTCATCTTGGACATCC
TGATTTCCGTTAGTTTCATCTGGTTGGCGGGACAAGATAGGCATGATTCTTTGTTCTTTT
GTCTTAGACGGCTGGTCCCATCTGCTTTTGCGCTTGCGTCCATTTGTCTCAGGAAGACCG
AAANAGGTTCTGAATATCCCTCAAAACAGATGCTGTTTCAAGAGTTGCACCCTTGATGAT
GTGACCGACGCACCTGGTTCTGCAGGGCTTGGGGAATGATGATCCTATC
GenBank Accession BX533824 [GenBank]
Graphic View Graphic view of gene At1g77300
Predicted Position of Insertion Chr1:29040072 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T14N5
Hit Gene Code At1g77300 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation histone-lysine N-methyltransferase
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03