SimpleSearch - Line and FST details


Line specific information

 
Line ID 509E02
Vector Used pAC161
Line Availability only available from NASC (N448818)
Segregation Analysis 50:45:33
Confirmed for Hit At5g63030
Parent of DUPLO pair none
Parent of pair(s) 2014

Gene hit At5g63030

 
Sequence (A. th genome BLAST matches underlined)
>13-K019531-022-509-E02-8409
GATGTGATCATGTAATATATACTGATAGATCCGGTTCTCAAATTTGATTCTGACTAGTCT
ATCGTATCCTCCCTATAGTGAGTCGTATTACTCAANAAAGGGGGGGTTTNNNTCCTTGCT
TTCTCTTATGAGTGAGACTGATCAGAACCTGACGTTTTATACAAATGTGCTTTCATTTTA
TAATAACGATGCGGAGATCGGCATGTTTTAATTGTAAAAAAAGTTGTTCTTAGTCGGTCT
TTTTCCCTTCATTATTATAAGATAATCAGAGATCATCCATGAAGATGGTCCCATTATAAA
AAGGAAGACAAGTGCANTTTTTTGTCTTTCTAAATGGATATCTCGCAGCGTTATTATAAC
CNNNNNNGGGNNNNGGNNNNCCNNGGNGGNNNNNGGNNNTNNNCCGNGGGNGAAAAAGCN
CNNTTGCCCGGGGGGCGGGGNGGACTGTATCTTTGGTATTTTTGGAGGAGACAAGCGTGG
CGTGCCCCACCATGGTGACGAAGATTTCTTTCTTGCATTGCGGACGACCAGACTCTGTAT
GAACTGGTCGCCGGTCTATACGGCGAGTTGGGTAAGGGCCTCTATTTAATCTTTGGTTCA
AGGGGAATGGGGGATC
GenBank Accession BX534444 [GenBank]
Graphic View Graphic view of gene At5g63030
Predicted Position of Insertion Chr5:25286767 - go to primer design
BLAST e Value 8e-24
Hit Clone Code (BAC ID) MJH22
Hit Gene Code At5g63030 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Thioredoxin superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03