SimpleSearch - Line and FST details


Line specific information

 
Line ID 511C01
Vector Used pAC161
Line Availability only available from NASC (N448985)
Segregation Analysis 50:44:32
Confirmed for Hit At3g61470
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g61470

 
Sequence (A. th genome BLAST matches underlined)
>03-K019928-022-511-C01-8409
TGATCTGAAATNCCCGGACTGAAGCCATTTACATGTGAATATATTGTGAAACTATTAGCA
CGTGTGAACTCTCGTCACACCCATCTTATATTTTCACGCTAATTCAGCCTAGATATTGCT
TGATTTTTTAGAAAGAACAATAACGCTTATGTGTATCTCTCCCAATACTGAGAGAGTCTT
GAAGGTCAACAACTTCTAGAATAATGGCATCATCTCTTTGTGCTTCTTCTGCCATCGCTG
CCATTTCTTCTCCAAGGTAAGCTCATCTTTTTCTCTCTTCTTATCAATTATCATCACTTG
CTATGTAGGAATGAGACTAAGATCCTTGTACAGTTGCACTTTAATTAGTTTCGTTAACAT
GACTATGATAGTGATCCATTGATTGGGATTTATGATCTATGGGATCCTCCCNAATAGTGA
G
GenBank Accession BX534663 [GenBank]
Graphic View Graphic view of gene At3g61470
Predicted Position of Insertion Chr3:22745591 - go to primer design
BLAST e Value 2e-110
Hit Clone Code (BAC ID) F2A19
Hit Gene Code At3g61470 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation photosystem I light harvesting complex protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX649848 [GenBank] BX534662 [GenBank] BX534662 [GenBank]


Last Updated on 31.08.2016 09:40