SimpleSearch - Line and FST details


Line specific information

 
Line ID 511G09
Vector Used pAC161
Line Availability only available from NASC (N449041)
Segregation Analysis 50:49:37
Confirmed for Hit F1N21
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit F1N21

 
Sequence (A. th genome BLAST matches underlined)
>71-K021258-022-511-G09-8409
AGGAAATTTAGATTTTTTTTGGTGGGTGAATTAGTTTTGACCGGTTAACGAAACTATAGA
TATGGAATAAATGTGTAGTGTACCTATAACCACCTAACCTAAACCTTATCCCTTTATTTA
GGGTTTTTGTGCAAAGAGAAAAGAGGCCTTAATGTGACCCGAGTTGGTTTCCCGTACGAT
TGAAGATTGTGAAAAGATTTGTCGTTTTAAATTTTCTTTTGACGTCTCTA
GenBank Accession BX649912 [GenBank]
Graphic View Graphic view of sequence BX649912 of line 511G09
Predicted Position of Insertion Chr1:25170133 - go to primer design
BLAST e Value 2e-91
Hit Clone Code (BAC ID) F1N21
Insertion Classification Genome Hit
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX534736 [GenBank] BX649912 [GenBank]


Last Updated on 31.08.2016 09:40