SimpleSearch - Line and FST details


Line specific information

 
Line ID 513C07
Vector Used pAC161
Line Availability available as T3 set from NASC (N449183)
Segregation Analysis 50:48:38
Confirmed for Hit At2g02148
Parent of DUPLO pair none
Parent of pair(s) none
Note

Gene hit At2g02148

 
Sequence (A. th genome BLAST matches underlined) 
>513C07-LB-2-547725-R-150-a
GATTGATGAAATTGATGAGACAAAGATGACATATGATGTTTGGAAGGAGAAGGAGTGTGT
TGTTGTTGGCTTTGATCCTGCAATTATGACAAAGATGGTTGATAAATTCGATGAACTCAA
GATCATTTCCATTAGAATTTGCCATTGATT
GenBank Accession KG787123 [GenBank]
Graphic View Graphic view of gene At2g02148
Predicted Position of Insertion Chr2:547725 - go to primer design
BLAST e Value 3e-80
Hit Clone Code (BAC ID) F5O4
Hit Gene Code At2g02148 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation PPR containing protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit KG787123 [GenBank]

Gene hit At2g38410

 
Sequence (A. th genome BLAST matches underlined) 
>51-K019930-022-513-C07-8409
GGGGTGATCTGTAGATTTCCCGGACATGAAGCCATTTACATTGATATATCCTGTTGAACA
ATTTACAAAAGCCTTAAACNCCAAAGATTCTTCGCTGACTTCGTTCTCTCTTTCGCTGGC
GCAAGATGATTTTCTATGGGATCTCACCTATAGATGAGACGAAACAGACTGAGTTTTCCC
TTTTTTTTTTCAATACAAAAATG
GenBank Accession BX534896 [GenBank]
Graphic View Graphic view of gene At2g38410
Predicted Position of Insertion Chr2:16090202 - go to primer design
BLAST e Value 2e-15
Hit Clone Code (BAC ID) T19C21
Hit Gene Code At2g38410 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ENTH/VHS/GAT family protein
Insertion Classification TS2TE (5')
Confirmation Status failed


Last Updated on 10.06.2021 13:37