SimpleSearch - Line and FST details


Line specific information

 
Line ID 513E07
Vector Used pAC161
Line Availability only available from NASC (N449207)
Segregation Analysis 50:42:33
Confirmed for Hit At3g61830
Parent of DUPLO pair none
Parent of pair(s) 1435, 3488, 3517

Gene hit At3g61830

 
Sequence (A. th genome BLAST matches underlined)
>53-K019923-022-513-E07-8409
TGATCTGTAGATTTCCGGACATGAAGCCATTTACATTGCACTCATGGTGGATTCTCTAGT
GCTACGTAAACACGCCACTGAATGCTTGCCTTCTTTGGTAAATATATTCTTAAAGAAACC
TTCTCAATTCAAGAAACTTTAGCTTGAATTCTCACTCCAATTTTACACTTTTTAGGATAT
GACACAAGCTACTCCTACTCAAGAACTTGTGACTAGGGGATCCTCCCTATAGGGAGAAAT
GAAAAGGCCTACCTCCGAAGACATTATTTTTATGCATTGCAGTGCCTGTGGGATCCGCCN
TATAGTGAGAAGAGACGTTGACCCAGGGGGTGGAGCAATGGGAGTGAGAGGTCCACAGAG
GGGTTTGCTCACTACAGCATGGAGTAGCTGGGCAGCCTAGAAAGGACGTGTCGATGGAGA
TGGTATTGTGGACTTGAGGTCGGGTGGGACTGAAACTGTATTGTCTGTCGTTGATCAGGC
GCATGAACAGAAATGTAGAGCCTTTGTGTTTTTCAGGGGTGAGAATGGGGATTTACGGGT
TGGAGTGAGACGATTAGCTCGGCATCAAAGCACAATGCCTACTTCGGTTATTTCAAGTCA
GAGCATGCATTTGGGAGTTCTTGCTACAGCTTCTCATGCTGGGCGAACAACAACAATCTT
TGTTGTCTTTTACAAGCCTA
GenBank Accession BX534923 [GenBank]
Graphic View Graphic view of gene At3g61830
Predicted Position of Insertion Chr3:22889119 - go to primer design
BLAST e Value 3e-94
Hit Clone Code (BAC ID) F15G16
Hit Gene Code At3g61830 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation auxin response factor 18
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX534924 [GenBank]


Last Updated on 07.07.2016 14:03