SimpleSearch - Line and FST details


Line specific information

 
Line ID 516F12
Vector Used pAC161
Line Availability only available from NASC (N449512)
Segregation Analysis 50:49:40
Confirmed for Hit At1g03970
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g03970

 
Sequence (A. th genome BLAST matches underlined)
>94-K019970-022-516-F12-8409
GGAAGCTCCCTCGTCCATTTCTGCTTTCGCTAAGAAATCCTCAAGTGTCATTATATCTTC
TGGTTCTTCTTCCTTCATCATGATCGTCTTTTGCTCTCCAGATACAATCTCTTTCCAAAC
ATCGTCAACACTCTTTCCGTTGTTAACGCTGTTCCGATCTCCGATACTCCGATCAACATC
AATCGCCATCTCGAAGGGCTTTGAATCAGACGCGAAAGTGTAATCGTTGACTCCTCCGCC
GTAAGCGAAACTGATTCTGGAGTGATCGGCGTGAGGATTTGGTCGGAGATGGTGCGATGA
TCTTATAGAAGGGGAAGATGAAGCAGAAGAAGAATTACGGCGAGACAAGTCGGAATTGGA
AGAAGACATCAACTTGAAGGACGCCATTTCCGGAGCTCACTGGAATTGGAACGAATTTTT
ATCTATCTGGGTTTTGTCAAAGAGAAAGAACAATCGGAAATGGTGGATTTTCTTCGAACC
AGAGATCGAGAGAGATCTTTCTATG
GenBank Accession BX535316 [GenBank]
Graphic View Graphic view of gene At1g03970
Predicted Position of Insertion Chr1:1018630 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F21M11
Hit Gene Code At1g03970 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation G-box binding factor 4
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03