SimpleSearch - Line and FST details


Line specific information

 
Line ID 516G02
Vector Used pAC161
Line Availability only available from NASC (N449514)
Segregation Analysis 50:50:37
Confirmed for Hit At4g02890
Parent of DUPLO pair none
Parent of pair(s) 53260, 89731, 89732, 89737

Gene hit At4g02890

 
Sequence (A. th genome BLAST matches underlined)
>15-K019946-022-516-G02-8409
CCCGGACTGAAGCATTTACATTGTTCACTATGTTTCCGTTCCTGTGTTATACCTTTCTTT
CTAATGAGTAATGAGCTCAAACTTCTTCTGTATTGGAATTATGTCCTTGTGAGTCTCTTT
ATCATCGGTTCGTCTTTACATTATATGTGCTACTTTTGTCTAATGAGCCTGAAAAGTGGC
TCCAATGGTACGCACTGGAAGATTTGTTGGCTTCTGGTATATATAGCGACAGTGTTGAGC
TTGTAATATCATGTCTCTTATTGCTAAATTATTTCCTTTCTTAACAGAAACCTTCAAAGT
TTTTGTTTTTGTTTTCATTTACCTAATGTACACATACGCTGGCCATGACTAACAACATGT
CCAGGCTTATAGCATATTTTTTCCTATGGGATCTCCCTTATTATTGAGAGGATCTTGGCT
TTGACATTGTCGATAGTGTCAGAGCTCTCCACCTCCAAAGTGATAGTCTTTCCAGTCAAC
GTCTTGACAAAGATCTGCATACCACCACGGAGCCTGAGAACAAGATGAAGTGTGGACTCC
TTCTGGATGTTGTAGTCAGCAAGAGTTCTGCCATCCTCCAACTGCTTTCCAGCGAAGATC
AACCTCTGCTGGTCCGGAGGAATACCCTCCTTGTCTTGGATCTTGGCCTTGACGTTGTCG
ATGGTGTCAGAACTCTCCACCTCAAGAGTAATCGTCTTTCCCGTTAAGGTCTTGACGAAA
ATCTGCATACCAACACGGAGCCTGAGAACCAAGTGGAGGGTGGATTCCTTCTGGATATTG
TAATCAGCCAACGTACGGCATCCCC
GenBank Accession BX535317 [GenBank]
Graphic View Graphic view of gene At4g02890
Predicted Position of Insertion Chr4:1278756 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T5J8
Hit Gene Code At4g02890 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Ubiquitin family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Other FSTs Supporting this Hit BX535318 [GenBank] BX535317 [GenBank]


Last Updated on 31.08.2016 09:40