SimpleSearch - Line and FST details


Line specific information

 
Line ID 516G02
Vector Used pAC161
Line Availability only available from NASC (N449514)
Segregation Analysis 50:50:37
Confirmed for Hit At4g02880
Parent of DUPLO pair none
Parent of pair(s) 53260, 89731, 89732, 89737

Gene hit At4g02880

 
Sequence (A. th genome BLAST matches underlined)
>54-K102872-0022-516-G02C-8409
ATTTACATTGTTCACTATGTTTCCGTTCCTGTGTTATACCTTTCTTTCTAATGAGTAATG
ACATCAAACTTCTTCTGTATTGGAATTATGTCCTTGTGAGTCTCTTTATCATCGTTTCGT
CTTTACATTATATGTGCTACTTTTGTCTAATGAGCCTGAAAAGTGGCTCCAATGGTACGC
ACTGGAAGATTTGTTGGCTTCTGGTAGATATAGCGACAGTGTTGAGCTTGTAATATCATG
TCTCTTATTGCTAAATTAGTTCCTTTCTTAACAGAAACCTTCAAAGTTTTTGTTTTTGTT
TTCATTTACCTAATGTACACATACGCTGGCCATGACTAACAACATGTCCAGGCTTAGAGC
ATATTTTTTTCTAGCTTAAATTGTTAACTTGTCATTCAGTAAAATCCGAGAATTGTGAAG
CTCTAATT
GenBank Accession HG969012 [GenBank]
Graphic View Graphic view of gene At4g02880
Predicted Position of Insertion Chr4:1278647 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T5J8
Hit Gene Code At4g02880 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation unknown protein
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03