SimpleSearch - Line and FST details


Line specific information

 
Line ID 519H04
Vector Used pAC161
Line Availability only available from NASC (N449816)
Segregation Analysis 50:39:27
Confirmed for Hit At4g02200
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g02200

 
Sequence (A. th genome BLAST matches underlined)
>32-K020206-022-519-H04-8409
CGTGTGGATCCTCAATCAAAACGGAAGAAGATTTGTTGGGCATTTGTGGGTTTGATTCGT
CGAAGAAATATCGATTAGAAGAACTTGCCAAGTATCAGTCGGGTTAGTGTAAAGATCCAT
TCTTTTTCCCAATTGCATTTAGCTTTGTTTTAGGGTTTATGCTTTATATGCAGGTGGTTT
TAATTTCTTTATCAAATTTCAATTCTTTTGGCCCTTAAGGTCTATGGGATCCTCCCTATA
TTGAGANAAAAANAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAAATGTCCG
CAGCGTTATTATAAA
GenBank Accession BX535653 [GenBank]
Graphic View Graphic view of gene At4g02200
Predicted Position of Insertion Chr4:972732 - go to primer design
BLAST e Value 4e-114
Hit Clone Code (BAC ID) T10M13
Hit Gene Code At4g02200 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Drought-responsive family protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03