SimpleSearch - Line and FST details


Line specific information

 
Line ID 520G04
Vector Used pAC161
Line Availability available as T3 set from NASC (N449900)
Segregation Analysis 50:46:46
Confirmed for Hit At2g45560
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g45560

 
Sequence (A. th genome BLAST matches underlined) 
>31-K020047-022-520-G04-8409
TTCGCTATCTTGCGATGGGATCCTCCCGATAGAGAGAAGGCATCAATATGGATACTTTTG
ACTTCTTCAAGCTCTATGCGACTCTCGAGAGAGAAGAGAACAAACCCTATGGGATCCTCC
CTATGGGGAGAGCNNNNGNANNNNGCTCGGGCGATCATTTCTCCGATCATTATT
GenBank Accession BX535724 [GenBank]
Graphic View Graphic view of gene At2g45560
Predicted Position of Insertion Chr2:18776174 - go to primer design
BLAST e Value 4e-13
Hit Clone Code (BAC ID) F17K2
Hit Gene Code At2g45560 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation cytochrome P450, family 76, subfamily C, polypeptide 1
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37