SimpleSearch - Line and FST details


Line specific information

 
Line ID 522D02
Vector Used pAC161
Line Availability only available from NASC (N450054)
Segregation Analysis 50:47:44
Confirmed for Hit At4g10955
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g10955

 
Sequence (A. th genome BLAST matches underlined)
>12-K020204-022-522-D02-8409
ATGACTCGTACCTTACTAATGCGAATAGACATCATACTTCTGAGTACTTATGAGTCCTAT
TATGAATCCTTTGTAAGGATCGTAAAAATCATAACTTTACCGGATTGATGATGGATATTG
AATCGATGAAACTCTATACTATCATCAATCTTTCTATGGGATCCTCCCTATAGAGAGACT
AGCACTCTTTCGCTAGAGATCACAAAGCAATCTAAAAACATTTCTCTTGATCTTTTTCCT
TTACCAAAAAACAAAGATCCTTTCTTCTGTTTCGTAATGATGGCTATGGGATCCTCCCTA
TAGTGAG
GenBank Accession BX535932 [GenBank]
Graphic View Graphic view of gene At4g10955
Predicted Position of Insertion Chr4:6718818 - go to primer design
BLAST e Value 6e-51
Hit Clone Code (BAC ID) F25I24
Hit Gene Code At4g10955 [TAIR] [MIPS] [SIGnAL]
Gene Annotation alpha/beta-Hydrolases superfamily protein
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At1g60440

 
Sequence (A. th genome BLAST matches underlined)
>12-K020049-022-522-D02-8409
CCTATCGTGAAGAGATCACAAGAACTCTAGTTTTCTCGAAATCAGTAAGCTAATGACTCA
TACATTACTACTGCAAATAGACATAATACTTCTGAGTACATATGAATCCGATTATGAATC
AGAGGTTAGGATCATAAAAATCAAAACTTTACCGGAATGATGAAGGATATTGAATCGAAT
AAACTCCAAACAATCATCAATCTTCCTATGGGATCCTCCCTATAGTGAGANNNNNNNNNT
GenBank Accession BX535931 [GenBank]
Graphic View Graphic view of gene At1g60440
Predicted Position of Insertion Chr1:22268585 - go to primer design
BLAST e Value 2e-96
Hit Clone Code (BAC ID) T13D8
Hit Gene Code At1g60440 [TAIR] [MIPS] [SIGnAL]
Gene Annotation pantothenate kinase 1
Insertion Classification CDSi
Confirmation Status unknown


Last Updated on 14.10.2014 10:23