SimpleSearch - Line and FST details


Line specific information

 
Line ID 523B08
Vector Used pAC161
Line Availability only available from NASC (N450132)
Segregation Analysis 50:21:19
Confirmed for Hit At5g66210
Parent of DUPLO pair none
Parent of pair(s) 5406, 5415, 81980, 82150

Gene hit At5g66210

Sequence (A. th genome BLAST matches underlined)
>58-K020207-022-523-B08-8409
AACAACTCCAGACAACCCGCGAGAAACAGCCGTCTAAAGCAACCCGCTCCAAGGGTAAGT
TAAACGAGGAAGTTGTTGGATGGATAAAAACAAAGTGATCCGGACATGTCTCTAATGCTT
TGTGTCTCCTTCTGGCAGGCGCTTGCTATGGGATCCTCCCTATAATGAGCTTAACTCTTT
GCATACATTATTTTGTCGTAGAACTGTACTGATTGTGAACATTATTCTTAACTCTCTGAG
AACTCTATGTTGGGTTTTG
GenBank Accession BX536033 [GenBank]
Graphic View Graphic view of gene At5g66210
Predicted Position of Insertion Chr5:26457632 - go to primer design
BLAST e Value 1e-49
Hit Clone Code (BAC ID) K2A18
Hit Gene Code At5g66210 [TAIR] [MIPS] [SIGnAL]
Gene Annotation calcium-dependent protein kinase 28
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Related paper(s) [Matschi et al. 2013, cpk28-1]

Gene hit T22P11

 
Sequence (A. th genome BLAST matches underlined)
>58-K020210-022-523-B08-8409
AACCATTTACATTGAATATCCCTGTCGACATTTCAGTTCTGAACAACTTAAGACAATTTG
TGAGATACAGCCGCTCTAAAGCAATTTGCTTTAAGGGTAAGTTAAATGAGGAAGTTGTTG
GATGGATAAAAACAAAGTGATCCGGACATGTCTCTAATGCTTTGTGTCTCCTTCTGGCAG
GCGCTCACTATGGGATCCTCCCTATAGTGAGCTTAACTCTTTGAGTACATTATTTTGTCG
TATAACTGTACTGATTGTGAACATTATTCTTAACTCTCTAAGAACTCTATGTTGGGTTTT
GTTTTTCTAAAAAAAAATTGCCAATGGATTGGGCCTCCACTTGAAACTACAAATCATTCG
TTTCAAAACAAATAGATCTTTATCGTATAAGTGTATCATATGTATAACCAAACAAGAATC
AACAATAAAATAAAGATCAAACTGTTGCTACATATAAAATTGTAAAATACACATCTTATT
GCATCATCTGGTTCTTATTTCAATATTTCATATCCAATGAACACCATTCCGTATCAGATG
TTTTT
GenBank Accession BX536034 [GenBank]
Graphic View Graphic view of sequence BX536034 of line 523B08
Predicted Position of Insertion Chr5:596191 - go to primer design
BLAST e Value 6e-156
Hit Clone Code (BAC ID) T22P11
Insertion Classification Genome Hit
Confirmation Status unknown


Last Updated on 14.10.2014 10:23