SimpleSearch - Line and FST details


Line specific information

 
Line ID 523C11
Vector Used pAC161
Line Availability only available from NASC (N450147)
Segregation Analysis 50:23:21
Confirmed for Hit At4g28350
Parent of DUPLO pair none
Parent of pair(s) 6278

Gene hit At4g28350

 
Sequence (A. th genome BLAST matches underlined)
>83-K020210-022-523-C11-8409
AAGAGATTTGATTGGTTTGTTCTCGATTCGACGAGCCGATTGTTCAAATATATTGTCTGA
AACTGGAAAGATCTGTTCCAGAGTCAAAATTATTAAGGAGATAATGTTGTTTAATGTATA
TATGCTAATTATATGTGTTAAAAATCTGTTTGAACAACAAATGTGGACGAAATAATATCC
GCCGTGATAATTTGATCTCTCGTTTATTTATTTTCCTAAGCATTTGGAATTTTGTTTTTG
TATATTTCTTGATCCAAGCCACTTGGAATTAATCGTGAAATTGTTGGACTTGGTATTTCG
CTGTCCACATTTATAGGTGTGAATAATGATGAACTTATTCGTCAAAAAAGTCAGCTTTGA
AATGTCAAATATTCATCTTCTTCTTGATTCTCCTCTTTAATTCTTTCAAACATATCGCAC
ATAACTCAAATTATTCGTCACCTGTAAGCATCATAGTATTAATAGGACCTATGGGATCCT
CCCTATAGTGAGA
GenBank Accession BX536061 [GenBank]
Graphic View Graphic view of gene At4g28350
Predicted Position of Insertion Chr4:14026500 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F20O9
Hit Gene Code At4g28350 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Concanavalin A-like lectin protein kinase family protein
Insertion Classification 5' region
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23