SimpleSearch - Line and FST details


Line specific information

 
Line ID 523C11
Vector Used pAC161
Line Availability only available from NASC (N450147)
Segregation Analysis 50:23:21
Confirmed for Hit At4g28350
Parent of DUPLO pair none
Parent of pair(s) 6278

Gene hit At4g28350

 
Sequence (A. th genome BLAST matches underlined)
>83-K020207-022-523-C11-8409
CTCCTCGGTAACGAGAATGTTAAATCTCCACCGTCAATCCTCACACTCACGAACCAAACC
ACTTTCTCCATCAGACGTGGCCTCTACCCTTCCTGAATCATCGCCTCCTCCTCCTGTGCC
TCGCCGTTACCTTTCGCCACATCATTCATCTTCTCCATGGCTCCTTTTAAACACCTCTCT
CCTGGCCACGGCTTCGCCTTCGTCTTCCTTCCTTTCTCCGAAACCTCCGCCGCAAGCTCA
TCTCAGCATCTCGGCCTCTTCAACTTCACCAATAACGGTGACCCCAATAGCCGAATCTTC
GCCGTTGAATTCGATGTTTTCGCTAACCAAGAGTTCAATTTTTTCAACGACAACCACGTC
GGCGTCGACGTCAATTCTCTCACTTCCGTTGCATCTGAAACTGCAGGTTTCTATGGAGGC
AGAGACGGCCAGAGATTC
GenBank Accession BX536060 [GenBank]
Graphic View Graphic view of gene At4g28350
Predicted Position of Insertion Chr4:14026621 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F20O9
Hit Gene Code At4g28350 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Concanavalin A-like lectin protein kinase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX536060 [GenBank]


Last Updated on 31.08.2016 09:40