SimpleSearch - Line and FST details


Line specific information

 
Line ID 523E10
Vector Used pAC161
Line Availability only available from NASC (N450170)
Segregation Analysis 50:49:38
Confirmed for Hit At1g64235
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g64235

 
Sequence (A. th genome BLAST matches underlined)
>77-K020210-022-523-E10-8409
GATTTTGGATTCCTTTTGTTTTCTGTGCAAAACATGAGAATTTGTTTAGGTATTTCTTGG
ATAATGAAGGATTCCAATTGCATGGTATTGCGTAATGAACGCGTTTTTCCTTGTTAATCA
ACATGAACGTAATTAGTTGCTATGTAAATAACTAAATATAGCCTAAATGATTGGCTAAAT
CACTACATGAATTATTTTCAGTATTTAGAATATTTCATTGGTTAATAATAATACACCATG
ATTTACAGATTTTACATTCAAATCATCATAAATTAAATGAAAATTCAGATTGAATGAAAA
GTTGGATGACCTATGGGATCCTCCCTATAGTGAG
GenBank Accession BX536099 [GenBank]
Graphic View Graphic view of gene At1g64235
Predicted Position of Insertion Chr1:23836265 - go to primer design
BLAST e Value 7e-174
Hit Clone Code (BAC ID) F22C12
Hit Gene Code At1g64235 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX536098 [GenBank]


Last Updated on 07.07.2016 14:03