SimpleSearch - Line and FST details


Line specific information

 
Line ID 524F10
Vector Used pAC161
Line Availability only available from NASC (N450278)
Segregation Analysis 50:49:36
Confirmed for Hit At5g19200
Parent of DUPLO pair 1019
Parent of pair(s) none

Gene hit At5g19200

 
Sequence (A. th genome BLAST matches underlined)
>78-K020209-022-524-F10-8409
AATTTATCTTAAAAAAAATGTAAAAGATTCATTGTTTACCTTGTTCAAACCCGGGTGTAT
CAGTGTCAGGAGGAAACAAGAGAGTCACATGAATGCCATCAGAAATAACTTCTTGCTGCA
ATGCTTGCGCTAAACCCTGAAGCCCAAACTTGCTCGCTGAATATGCAGTGTAACCATATA
TACCTGCCTGAAAACGTAAAAACACACGATACATCACAAAGTGCTCTCGACTTCCACAAG
TGCTTCCATTTTTACAAACTCAATTCAACAATTACCAAACTGCTTTAAATTCTTAATCTA
ATCTGCGAGTTATGATTCTATGATACGGCGTTAAGAGTGATAGAGATACGAACCTGACCA
GCTTGAGAGGACACAAGAGAAATGGAAGCAGGACCACGACCTTCCCTATGGGATCCTCCC
TATAGTGAGACTNTNNNATCCTCCCTA
GenBank Accession BX536226 [GenBank]
Graphic View Graphic view of gene At5g19200
Predicted Position of Insertion Chr5:6459872 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T24G5
Hit Gene Code At5g19200 [TAIR] [MIPS] [SIGnAL]
Gene Annotation NAD(P)-binding Rossmann-fold superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX536227 [GenBank]


Last Updated on 14.10.2014 10:23