SimpleSearch - Line and FST details


Line specific information

 
Line ID 526E04
Vector Used pAC161
Line Availability only available from NASC (N450452)
Segregation Analysis 50:41:30
Confirmed for Hit At1g27610
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g27610

 
Sequence (A. th genome BLAST matches underlined)
>29-K020218-022-526-E04-8409
CCATTTACATCGAAAAATACTCATTGACCATCATATATGTGATTTGTGTTTCTATAAGAA
ATAATGCTCTATGATAAATACAGTATACAGTTATCAACCTAGCTATGGGATCCTCCCTAT
AGTGAGATCTGAAGCCTACACACCACATAGGTGTACAAATCCATAAAATTTGAGCAATAA
CCCGATAATATAGCAGAAAGCAAAAAAATGTAATCCAAAACCTAAGAAAGTCCTATAAAT
GATAATCATATAAGCACATACCTTGAAAAGCTCGAAGAGCTTCTTAGGATCTTCTTCTTT
TTTGTTGAATTCCTCGCGGATCCACTTCTCATCCTTAGTGGAGAAGGGTTTGTAGGAATC
TTCTTCTGGTTGATAGTTGCTTTGAAAGAAGAAGCTCCAACAAGCATGTGTTATAAGCTG
TCTTTCTGGTGTGGGAAACAGAACTCTTATATGAATATTTATAAAGGTGTTCATTAGTTT
CCTTCAATGTTTACAATCTTCCTCATGATTTCGCTATGGGATCCTCCCTATAGTGAGANN
NNNNNNN
GenBank Accession BX536434 [GenBank]
Graphic View Graphic view of gene At1g27610
Predicted Position of Insertion Chr1:9607194 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T17H3
Hit Gene Code At1g27610 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation hypothetical protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR397768 [GenBank] BX536433 [GenBank]


Last Updated on 07.07.2016 14:03