SimpleSearch - Line and FST details


Line specific information

 
Line ID 527D12
Vector Used pAC161
Line Availability only available from NASC (N450544)
Segregation Analysis 50:44:37
Confirmed for Hit At5g55120
Parent of DUPLO pair 1641
Parent of pair(s) none

Gene hit At5g55120

 
Sequence (A. th genome BLAST matches underlined)
>92-K022478-022-527-D12-8409
AGCCATTTACAATTGAATATATCAAATGCATATCGTTAACCAATTCGTTAATTGTTTGAG
TAATGTATCAAATGCCTTATGTTTCCTATGGGATCCTCCCTATAGTGAGACCTATTGCTC
CCCCCCTTAGAGGAGCTTGTTGACTCTCTGCCTACTCCGCCCTGGTAACACCCTTTGTTT
ATTCCCCATGGGATCCCCCCTATAGTGCGACCCTATCCTCCCCCCTCTAAAGTGGCTTTT
TCAATCCTCTTCTTTACCCCGCTTATCCTTCCATATGGACCCCCCCGTTTAGCCCCCCCT
TCGGACCCCCTCCATTTCGGGCCCCATTCCACCGCCC
GenBank Accession BX649984 [GenBank]
Graphic View Graphic view of gene At5g55120
Predicted Position of Insertion Chr5:22369841 - go to primer design
BLAST e Value 4e-21
Hit Clone Code (BAC ID) MCO15
Hit Gene Code At5g55120 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation GDP-L-galactose phosphorylase VITAMIN C DEFECTIVE 5 (VTC5)
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX649984 [GenBank]


Last Updated on 31.08.2016 09:40