SimpleSearch - Line and FST details


Line specific information

 
Line ID 528C10
Vector Used pAC161
Line Availability only available from NASC (N450626)
Segregation Analysis 50:32:24
Confirmed for Hit At3g51780
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g51780

 
Sequence (A. th genome BLAST matches underlined)
>75-K020333-022-528-C10-8409
ACCTGCCAACGCGAACCACATCTCACATATCTTCCTACTCTATTAGCGCTCTTACCGTGA
AAACATGCTTAACTAATCAAGAAAACTACCCTCAGCCTTACGCTGTGCTATACCGGCCCC
TTCAGCCTCAATGCCATCCAATTTGAGCAGCTGCCTCATAAAAAGCTCTGCACCCATGTC
AAACTCCCGCACCGCAACTTGCGTCCCTCCATTCACAGCAACTTCTAAAGCAACAACCTA
ATTACCAAAAAAAGCTATGGGATCCTCCCTATAGTGAG
GenBank Accession BX536505 [GenBank]
Graphic View Graphic view of gene At3g51780
Predicted Position of Insertion Chr3:19207156 - go to primer design
BLAST e Value 3e-96
Hit Clone Code (BAC ID) ATEM1
Hit Gene Code At3g51780 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation BCL-2-associated athanogene 4
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX536505 [GenBank]


Last Updated on 31.08.2016 09:40