SimpleSearch - Line and FST details


Line specific information

 
Line ID 529C11
Vector Used pAC161
Line Availability only available from NASC (N450723)
Segregation Analysis 50:47:24
Confirmed for Hit At1g33120
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g33120

 
Sequence (A. th genome BLAST matches underlined)
>83-K023730-022-529-C11-8409
AAGCATTTAAATTGAAAATAGAAATGTGTTTATTGGAATAATAGGTGAGGAAGGTAGAGA
TGTTGGATGGTGTAACCATTGTTCGATCTGAGAAGGTGAAGGATGAGATTGTTCTTGACG
GTAACGATATCGAGCTTGTTTCAAGGTCGTGCGCTCTGATCAACCAGGTACTCCATTCTT
TAACTATGGGATCCTCCCTATAGTGAGTCGTATTACTCACAGC
GenBank Accession BX891231 [GenBank]
Graphic View Graphic view of gene At1g33120
Predicted Position of Insertion Chr1:12011499 - go to primer design
BLAST e Value 6e-91
Hit Clone Code (BAC ID) T9L6
Hit Gene Code At1g33120 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Ribosomal protein L6 family
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23