SimpleSearch - Line and FST details


Line specific information

 
Line ID 532E11
Vector Used pAC161
Line Availability only available from NASC (N451035)
Segregation Analysis 100:87:83
Confirmed for Hit At4g23010
Parent of DUPLO pair 1610
Parent of pair(s) none

Gene hit At4g23010

 
Sequence (A. th genome BLAST matches underlined)
>85-K020373-022-532-E11-8409
AGATTAAAATTATATATGACATGAAGCCATTTACACTGATAGCTATCATTATCTAAAATC
ACATTTCGTTGTGTGTAGATAACAACGCCTATGGGATCCTCCCTATAGTGAGANNNTTNN
NANANNNANTNNTGNNNNNTTTTTGTNNNTTNNNATTTNTATTTGNCCTCTTCNNTATAT
AAAACTATANAATCCTTCCTAATACGACCAAAACTTAATTGCCTCCTCATTTTTATGCGA
AAACAATAAACAAATTATTCTAATTCTTAAATCTTTATTTCAACGTATCTACATTCACCT
CCAAATATACAAACTATGGGATCCTCCCTATGGTGGACTACTCTGAATTGGTAGCGCCTA
TTTGGACGGCAATGTACACCTNATTCGATTTCGGAAATCTTTATTTCNACNNGNCNACNT
TC
GenBank Accession BX546674 [GenBank]
Graphic View Graphic view of gene At4g23010
Predicted Position of Insertion Chr4:12060630 - go to primer design
BLAST e Value 2e-11
Hit Clone Code (BAC ID) F7H19
Hit Gene Code At4g23010 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation UDP-galactose transporter 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit MKD15

 
Sequence (A. th genome BLAST matches underlined)
>85-K020364-022-532-E11-8409
TTATCTAAAATCACACCTCGTCGTGTGTAGATAACAACGGTTATGGGATCCTCCCTATAG
TGAGATCTTTTCTAAATGGGCTTATGATTTANATATGACGGTCCAATTCAAAATTTTGGC
TTTGCCGGATATTTCCAACGTACATCAACTCATCATTCCAAAAGGCTGCTATGGGATCCT
CCCTATAGTGAGTAANATTTTGCCAATTTTTATGTATTAAAGTTTGTTTGTATTCTAGCG
TCATGTTTTCATTCCATGTGATCATTTTTACTTCCTTTTTTGGGATCTCTAATATTATAA
CTTTAGCATGTGATTTAACCTTTAAGAAATTAAGGTCTTTGTTGACCGATGAATTATCTA
TTCGTAAATAGCTTCTTAATTTCAAATTAAAGGAATGGAANAANATATTTTGCANNTATG
GGATCCT
GenBank Accession CU589502 [GenBank]
Graphic View Graphic view of sequence CU589502 of line 532E11
Predicted Position of Insertion Chr5:7860056 - go to primer design
BLAST e Value 8e-72
Hit Clone Code (BAC ID) MKD15
Insertion Classification Genome Hit
Confirmation Status unknown


Last Updated on 07.07.2016 14:03