SimpleSearch - Line and FST details


Line specific information

 
Line ID 533B08
Vector Used pAC161
Line Availability only available from NASC (N451092)
Segregation Analysis 50:42:35
Confirmed for Hit At5g10740
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g10740

 
Sequence (A. th genome BLAST matches underlined)
>58-K020366-022-533-B08-8409
GAGAACGCCGGTGGATCCGTGACGTGGGCAGGTAAGTAGCAAGAAACTATAGGACTATAT
TTTCTGCTGCTTCATGCTTTTTTCAACATATAGTCCTAATTATAGGGGTGTGTTCATTCA
TAAACTAAATAGGAACTTGGAGGGTAGGAGGAGTTCTTGCAGTTTCTCGTGCGTTTGGTG
ATCGGCTTCTGAAGCAATATGTTGTTGCTGATCCAAAAATCCAGGTCTTTTCATCACTTC
TCTAAGAATCACATTGCATAATCTTTTTGTCCCCTTTTGTCTCCAGCTGACAAATTTCTC
AAACTTTTGTCATTGAATACAGGAAGAAAACATTGATGATACTCTTGAGTTTTTGATTCT
ATGGGATCCTCCCTATAATGAGAAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCA
AAAATGTAGATGTCCGCAGCGTTTTTATAAAAANAGACTATGGGATCCTCCCTATAGTGG
GCTAATGGGATCCGCCATATACCGTTAGGACGGGAATGTCC
GenBank Accession CU589531 [GenBank]
Graphic View Graphic view of gene At5g10740
Predicted Position of Insertion Chr5:3394622 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) MAJ23
Hit Gene Code At5g10740 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Protein phosphatase 2C family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX546701 [GenBank]


Last Updated on 14.10.2014 10:23