SimpleSearch - Line and FST details


Line specific information

 
Line ID 536D04
Vector Used pAC161
Line Availability only available from NASC (N451400)
Segregation Analysis 50:5:2
Confirmed for Hit At2g29410
Parent of DUPLO pair none
Parent of pair(s) 7159

Gene hit F16D14

 
Sequence (A. th genome BLAST matches underlined)
>28-K020490-022-536-D04-8409
AATTTACTTGTCACCAACTTCTCTCGGATCCAGCACAGAAGGAGTTGCTATTGTTCCCAA
CCTACCTATGGGATCCTCCCTATAGTGAG
GenBank Accession BX546972 [GenBank]
Graphic View Graphic view of sequence BX546972 of line 536D04
Predicted Position of Insertion Chr2:13299025 - go to primer design
BLAST e Value 1e-09
Hit Clone Code (BAC ID) F16D14
Insertion Classification Genome Hit
Confirmation Status unknown

Gene hit At2g29410

 
Sequence (A. th genome BLAST matches underlined)
>28-K020489-022-536-D04-8409
CCATTTACATTGAATATGAGTATGATGGATCGATATGGAGACAAGAACATTGCGTTTCCG
AGACGAAAGAACGCGAAGAATCGGCTATGGGATCCTCCCTATAGTGAGAGCTTTGGGATC
CTCCCTATAGGGAGCTTTGTGGACCCCCCCCTTGGGGGGGATTCGGGGCTTCCCCGGGGG
GCTTGGGTTTCCTCCTGATGGGGGGACTTGGGGCCCCCCCTATAATGGGGGCGCGGGGCC
CCCCC
GenBank Accession BX546971 [GenBank]
Graphic View Graphic view of gene At2g29410
Predicted Position of Insertion Chr2:12616924 - go to primer design
BLAST e Value 2e-17
Hit Clone Code (BAC ID) F16P2
Hit Gene Code At2g29410 [TAIR] [MIPS] [SIGnAL]
Gene Annotation metal tolerance protein B1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23