SimpleSearch - Line and FST details


Line specific information

 
Line ID 537B05
Vector Used pAC161
Line Availability only available from NASC (N451473)
Segregation Analysis 50:24:20
Confirmed for Hit At3g47810
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g47810

 
Sequence (A. th genome BLAST matches underlined)
>34-K020491-022-537-B05-8409
GGATCTTCCATGGGCGATCGCTGAGAAGATCCGCAAGAACTGGAACATCCTATTCCTTGA
AATCAGGAATCTTATTCGATAGTCTATTTGAGCCCTTGATCTGGTAAGCTCTGTCTGATC
TTCTAAAGTTTCGCTTTTTAACTTTTGGGGAAATCATCCACCTTTGTATCAAGTTTCTGG
CAATTTCTTCTCTGTAGTTAGAATCATTCAATAAGCCCTTTAATCTCTTCGACGCAGCTA
TGGGATCCTCCCTATAGTGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNN
GenBank Accession BX547063 [GenBank]
Graphic View Graphic view of gene At3g47810
Predicted Position of Insertion Chr3:17639595 - go to primer design
BLAST e Value 2e-121
Hit Clone Code (BAC ID) T23J7
Hit Gene Code At3g47810 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Calcineurin-like metallo-phosphoesterase superfamily protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX547064 [GenBank]


Last Updated on 14.10.2014 10:23