Line specific information

Line ID 541C06
Vector Used pAC161
Line Availability available from GABI-Kat
Segregation Analysis 50:45:42
Although the line exists, the insertion in At1g30040 can not be ordered because the confirmation of this insertion failed.

Genome hit F4N21

Sequence (A. th genome BLAST matches underlined)
>43-K023956-022-541-C06-8409
TCTTAGGAAGAGCACGGCTCCAACAAGTAACTGCGCAGTGCTTAAATCGTATATGCTAAA
GTCGTTGAAGAGGACTTGGAACTTCTATATTATCCCCCGTGTTTTGTCCAGTTTCTCTAT
AGGTTGTGCCTGAAAATATGGGTTTCTANNNNNNNNNNNNNNNNNNNNNANTCATCACTC
CTTTTCTTTATACATTTCCAGAAACATAGCACTCTGTTTTGGTTTTTTCATC
GenBank Accession BX891344 [GenBank]
Graphic View Graphic view of sequence BX891344 of line 541C06
T-DNA Border not detected
BLAST e Value 2e-64
Hit Clone Code (BAC ID) F4N21
Hit Gene Code  
Gene Annotation  
Insertion Classification  
Confirmation Status unknown

Gene hit At1g30040

Sequence (A. th genome BLAST matches underlined)
>43-K023854-022-541-C06-8409
CCTCTGTATTAAAGAATTCATCACTCCTTTTCTTTAGACCTTTCAACAAACAGAGCACTC
TGTTTTGTTTTTTTCAT
GenBank Accession BX891343 [GenBank]
Graphic View Graphic view of gene At1g30040
T-DNA Border not detected
BLAST e Value 1e-13
Hit Clone Code (BAC ID) T1P2
Hit Gene Code At1g30040 [TAIR] [MIPS] [SIGnAL]
Gene Annotation gibberellin 2-oxidase / GA2-oxidase (GA2OX2)
Insertion Classification CDSi
Confirmation Status failed