SimpleSearch - Line and FST details


Line specific information

 
Line ID 541D06
Vector Used pAC161
Line Availability only available from NASC (N451882)
Segregation Analysis 50:22:15
Confirmed for Hit T2E22
Parent of DUPLO pair none
Parent of pair(s) none
Note Although the line exists, the insertion in At2g31650 can not be ordered because the confirmation of this insertion failed.

Gene hit T2E22

 
Sequence (A. th genome BLAST matches underlined)
>44-K020609-022-541-D06-8409
TATTCTCTAATCTCTAGAGTCTGGAACACAAAAATAAATTTACCATGGCTTTGAATTTTA
CCGTTTCAGTCCCTTTTTATTTTATTTTCTTACTCACGCCCAATGTTGATGTATTATTTT
GAGATTATAAAACATTTGACCAAATAATAAAACTATTTTGATTTGCTTTCAATTTGGGTT
TAAATAAGAGTGAGGGTCTCTCTTTTTATCTCATAAACCACCTCCTTGTTGATCCTTGAA
GGCCATTTGTGTAAAAAAAAGGAGGGGGTCCGCAATTTTTCCAACACTGGTCATTTTTTT
TATCTGCTCCAGAGTCTTTATATTAGATTTAGGGTATATGACACCCCTGCTTCTGGTGCG
TAAGTTGGGACAACTCCAACCCCAAAAACCCCACCGGAGGTTGGGAAAAATA
GenBank Accession BX547451 [GenBank]
Graphic View Graphic view of sequence BX547451 of line 541D06
Predicted Position of Insertion Chr3:4024608 - go to primer design
BLAST e Value 6e-85
Hit Clone Code (BAC ID) T2E22
Insertion Classification Genome Hit
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX891358 [GenBank]

Gene hit At2g31650

 
Sequence (A. th genome BLAST matches underlined)
>44-K020614-022-541-D06-8409
TCCTTTGCTACTTTGAGCCTTTGTCGTTATACCATTACTAGAGGCCTTCCACGTGTTTCC
TCAAGACTTAGAATCAGAGACACGGAGACAACTATGGGAGACTCCCAAATGTGAGGGCTC
CGTCTCTTCACGATAAACCAAAAATTTGATCATTCCACGATCATGAACTATATCCTCATC
ACATCCATCCCTATATTTGACCTAAGGAAGAATTTAATCATGGGTAGAGGAACAAGCTTT
TACATATATCATAGCTCAAAGAACTACCCAACTCATAACTCAAGTAGAGTAGAGAATTAC
TTACAGTGTAACGCTTTCTCTCTGCACTATATCCAACAATGGAACCTTCATACCAAAGAG
CGTCCAGCGGCCAAAAAACCTATGGGATCCTCCCTATAGTGAG
GenBank Accession BX547452 [GenBank]
Graphic View Graphic view of gene At2g31650
Predicted Position of Insertion Chr2:13460878 - go to primer design
BLAST e Value 2e-134
Hit Clone Code (BAC ID) T9H9
Hit Gene Code At2g31650 [TAIR] [MIPS] [SIGnAL]
Gene Annotation homologue of trithorax
Insertion Classification CDSi
Confirmation Status failed


Last Updated on 14.10.2014 10:23