SimpleSearch - Line and FST details


Line specific information

 
Line ID 543A09
Vector Used pAC161
Line Availability only available from NASC (N452041)
Segregation Analysis 60:55:47
Confirmed for Hit At5g18450
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g18450

 
Sequence (A. th genome BLAST matches underlined)
>65-K021955-022-543-A09-8409
GCCTGTTCGCTCTTCCAACTCCGGCCTATGCATCCTCTCTCCGCCGCAACTAGGAACCAA
CATACTCTCCTTGTTGTCCGACGATCCACACGACGATGACACGTCATGTTCCGTCTTCTT
TTCTTGCCCCACAAGAAACCTATGGGATCCTCCCTATAGTGAGACNNANNNNNCNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
GenBank Accession BX650060 [GenBank]
Graphic View Graphic view of gene At5g18450
Predicted Position of Insertion Chr5:6116174 - go to primer design
BLAST e Value 3e-74
Hit Clone Code (BAC ID) F20L16
Hit Gene Code At5g18450 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Integrase-type DNA-binding superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX650060 [GenBank]


Last Updated on 31.08.2016 09:40