SimpleSearch - Line and FST details


Line specific information

 
Line ID 543H03
Vector Used pAC161
Line Availability only available from NASC (N452119)
Segregation Analysis 50:49:37
Confirmed for Hit T21L8
Parent of DUPLO pair none
Parent of pair(s) none
Note Although the line exists, the insertion in At4g34890 can not be ordered because the confirmation of this insertion failed.

Gene hit At4g34890

 
Sequence (A. th genome BLAST matches underlined)
>24-K021955-022-543-H03-8409
GNAGCCATTTACAATGTGAATATATCCCGGATAGCCTAGACACGAAGACCCGAGCCCCGG
CTTACCATTGCTCATCCCACTATGACATCACCTTCTGTAATGACCATCCTTATCTATGAG
GAAGATACTTGCGAAGAATAGTGTCACTGTCGTCAGTCTGCTACTTCTATGAAGACATCT
CCTTTGTGTACCTGATTGGAAAAGGTGCTTGTACCGTCATGCTCCACGAGGAGGCTCCTC
TGACACTCCTCGAATATCTCAGAGGTGCGTATCAACTTCTTTGATTAATATCCAGTTGCT
GGGGATGATTTCAAGTACTCAAACGAGTTTAATTTTCACTTCAATTTTGAACTGATACTC
TCTATGAAAATTCTGTTTTTTGGATTCCTATGGGATCCTCCCTATAGTGAGCTCATATGA
CATAGTAAGACGGACATCACGAAAGATTGATATATACAACAAGAGAACAGGAGGAACTTT
ACTCATAATGAAGAGGGAATAGCATATAGCTGACACGATGATCAACATGATCATACACCA
AAATAGGATAAAGTACAGAACAGAGAA
GenBank Accession BX650167 [GenBank]
Graphic View Graphic view of gene At4g34890
Predicted Position of Insertion Chr4:16625083 - go to primer design
BLAST e Value 1e-67
Hit Clone Code (BAC ID) F11I11
Hit Gene Code At4g34890 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation xanthine dehydrogenase 1
Insertion Classification TS2TE (5')
Confirmation Status failed

Gene hit T21L8

 
Sequence (A. th genome BLAST matches underlined)
>24-K021956-022-543-H03-8409
AATAGTATTTACACAGATTAGAAAAAGAAATAAAAGAAATGGAAAATTTAAATTTTGAAA
AACATATAGTAGAATGCTATATTTATTTCCAGCTTCAAGTTTATAAAATATAAAAGAAAA
AGAAAAATATATTTGTCAGTTTAGTAATTCTATGGGATCCTCCCTATAGTGAGACGTATT
ACTCCCCCCTTTTTTCGTGTTTGGTTCCTCTCCGTCTTCCCGCCTCTCTGGGCTCGGTTG
GGGTAGAAAACGTAGCGGGACCTTAAGGAAGGGAAAGGATAACAGCAGCCCGCGAATGCA
GAACAAGAGTGGCAAGGCAAGATCGAATGAAAGAGAAGCCTGATGCAGAAATGTAACAAG
AGGACCAAGAGCGTGAAAGAAAGACAGAATGAGAAATGA
GenBank Accession BX650168 [GenBank]
Graphic View Graphic view of sequence BX650168 of line 543H03
Predicted Position of Insertion Chr3:17475739 - go to primer design
BLAST e Value 4e-15
Hit Clone Code (BAC ID) T21L8
Insertion Classification Genome Hit
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03