SimpleSearch - Line and FST details


Line specific information

 
Line ID 544E07
Vector Used pAC161
Line Availability only available from NASC (N452183)
Segregation Analysis 64:60:47
Confirmed for Hit At2g22630
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g22630

 
Sequence (A. th genome BLAST matches underlined)
>53-K022081-022-544-E07-8409
GCCACATACACAGTGTACCACCCATGACACACGTGTCCACACACTGCCATGAGCCTACTT
CAAATTAGTGTGTGTTTTCATCTTTACACTATGGGATCCTCCCTATAGTGAGANANNNNN
ANATANANNNAANNAAAAANNAATATAATAAAAAAAAATTATATATAAACTTATATAAAG
AAGAAAACTTATAGAAACATCACTATTTAAAACAGCAACATAATTACCGAACTAAACAAG
CACAATAGTCAATATATAGAAAAAAAAAGCTATCCATGATCATCCCATGACAAAGTCCAA
AATCACAATACATTTTCACAATATAAACACTTATTAGAAAAGAATATGTAGAAAAAATAC
CA
GenBank Accession BX650236 [GenBank]
Graphic View Graphic view of gene At2g22630
Predicted Position of Insertion Chr2:9619138 - go to primer design
BLAST e Value 2e-32
Hit Clone Code (BAC ID) T9I22
Hit Gene Code At2g22630 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation AGAMOUS-like 17
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX650236 [GenBank]


Last Updated on 31.08.2016 09:40