SimpleSearch - Line and FST details


Line specific information

 
Line ID 544G08
Vector Used pAC161
Line Availability only available from NASC (N452208)
Segregation Analysis 50:49:29
Confirmed for Hit At3g10740
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g32090

 
Sequence (A. th genome BLAST matches underlined)
>63-K020964-022-544-G08-8409
GTAGAATGATCATCCTCCTCATCATCAGAAAATGAGAATCACCAATAATATACACCGCAG
GTAATAGTGGAGGTACATGATACACGCTCGTCTAATCGAGTGACAGTGAGTGGTACTTCA
TCTCTCCAAAATCAAGTCTACAGTTGCGATTATCCTTCCTCACACAACGCTTCAACTTAC
GAGCAGGCGTCGTCTCGTTATGAATATCACTACAGGACTCATCATTACAAGGAGCATGAG
TACCGTTACAATTGATCTCTA
GenBank Accession BX572262 [GenBank]
Graphic View Graphic view of gene At1g32090
Predicted Position of Insertion Chr1:11540559 - go to primer design
BLAST e Value 2e-26
Hit Clone Code (BAC ID) T12O21
Hit Gene Code At1g32090 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation early-responsive to dehydration stress protein (ERD4)
Insertion Classification CDSi
Confirmation Status unknown

Gene hit At3g10740

 
Sequence (A. th genome BLAST matches underlined)
>63-K022081-022-544-G08-8409
AATTGAATATATCCTGGAAAAAAAAAATGCTACTATGGGATCCTCCCTATAGTGAGGCAA
TTGAATGATCCGGTTGTTTATGACGGTCAACATTTGGAAAAGATCGTTTCAAGGACTATG
TCCCTGCAATCAACCAAAAAGATCTAGTATTTGATAAACTTCTTCTTCCAATATTTTCTC
TATTAGCAATCTGTAATCTTCCATCTCAAGGCTCTACAGGGAATCAGAGAGAGCGAAAAA
AGAACCTTGTGAGTATCCACTGGCATGGCCGAGACTTGGTCAATCCATATTGACCCTTTC
TTGGTTGTTGTTAACTGAAGTCTTGCACTATGGGATCCTCCCTATAGTGAGATAGAACAA
AAATATAAAATAAACATGATATTTACTATAAAAATTATCTATATACCATACCAACATAAT
AAAAAACAATAGAAAATTTAAAATAAAACGAGTGCTCAATGAGTTATATTTATATATACT
TATTTAAT
GenBank Accession BX650275 [GenBank]
Graphic View Graphic view of gene At3g10740
Predicted Position of Insertion Chr3:3363207 - go to primer design
BLAST e Value 1e-116
Hit Clone Code (BAC ID) T7M13
Hit Gene Code At3g10740 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation alpha-L-arabinofuranosidase 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03