SimpleSearch - Line and FST details


Line specific information

 
Line ID 546A07
Vector Used pAC161
Line Availability only available from NASC (N452327)
Segregation Analysis 50:43:34
Confirmed for Hit At3g09370
Parent of DUPLO pair 11827
Parent of pair(s) none

Gene hit At3g09370

Sequence (A. th genome BLAST matches underlined)
>49-K020965-022-546-A07-8409
CCATTTACATTGAAGCCATCATACTCAATACTAACCTCTTCCGGAGTTCACCACCTTTGG
CTCGCCTTATAGGGCCACTCGTCCTCTTGCATACCAAACACTATCAACGTCAATCTCTTG
TAGAAAAGATGCAAATTCGCGAACGAGTGCTGCGGAGGAGATACAAAACAAGGAAGAAGA
AGAAGGAGACGAACTAACCCGAGGTACCTATGAGTAGGTGAGACTGTGGCGGGACTTGCA
ATTGTAGGTGACTTGTGAGAGCGACCCTAATATGGCATCACATTACTCACAGCACGAAGC
AGGTGTTGATTGCTTATTTTCTGCCCACGGATCATCAATTTTCGCTTCACCTGTTTCATC
CTGAAAATCCATCATCTCAATGAAAGACAAAAAAGATCCAGACTTTGATAACAAACAGAG
AAACCCTAAAAAAGCAATCATCGTAAAACACAAAGCAGACAGAACCCAGATCTCACAAAT
CACGAATTCAGTAAACAGCTCAACATTAACACCAACCACAGCAAAATTAGGGTTTATAAC
AAT
GenBank Accession BX572313 [GenBank]
Graphic View Graphic view of gene At3g09370
Predicted Position of Insertion Chr3:2880238 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F3L24
Hit Gene Code At3g09370 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation myb domain protein 3r-3
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Related paper(s) [Kobayashi et al. 2015, myb3r3-2]
Other FSTs Supporting this Hit BX650440 [GenBank]

Gene hit T1O24

 
Sequence (A. th genome BLAST matches underlined)
>49-K020585-022-546-A07-8409
TCTGTACCTTCTTTCTTGAATCTGTATACCCTAATACAAAAACGTACTTATAGATTCCAA
GATCGCACTCTATGGGATCCTCCCTATAGTGAGAGCTATGGCATCCTCCCTA
GenBank Accession BX547584 [GenBank]
Graphic View Graphic view of sequence BX547584 of line 546A07
Predicted Position of Insertion Chr2:18059960 - go to primer design
BLAST e Value 2e-14
Hit Clone Code (BAC ID) T1O24
Insertion Classification Genome Hit
Confirmation Status unknown


Last Updated on 31.08.2016 09:40