SimpleSearch - Line and FST details


Line specific information

 
Line ID 547H03
Vector Used pAC161
Line Availability only available from NASC (N452503)
Segregation Analysis 50:48:35
Confirmed for Hit At5g03740
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g03740

 
Sequence (A. th genome BLAST matches underlined)
>39-K033039-022-547-H03C-3144
TCCACTATCTTCGCAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGACA
GGGTACCCGGGGAACCTATATTTGTTCTATCTTATCTTCCTTTGGGAGCAATTTCTCTGC
TTCTGTGGTCAAGCTCGAATCTGATTCTAAGTTTTCTTGGTTTATAAAAGCCTGAAGAAC
CCAAGAAGAGGTCTGCAGAACCCAACTCCTCCAAGAACCCTGCGTCCAACAAGAAGGCTA
AGTTTGTAACTCCTCAGAAAACAGGTGATTAAATCCTTTTTACCAATCTCCCCATTGAAT
ACTTATTTTAACGATAGAAAGGAAGATTGATTTGTTTAATTAAAAAACATTCGGACAAAG
CAGATTCGAAGAAACCGCATGTCCATGTTGCAACTCCTCATCCCTCAAAACAGGCGGGTA
AGAATTCTGGTGGAGGCAGCACTGGAGAGACATCGAAGCAGCAGCAGACACCGAAGTCTG
CAGGAGCGTTTGGGTGCAAGTCGTGCACCAGAACCTTTACTTCGGAAATGGGATTGCAGT
CTCACACAAAGGCCAAACACAGTGCAGCTGCTTGAGAAGAAGAAGCAGCATGATGACTAC
TCTCTATAATATCTACTCTAGAACTTTGATGTCTTTTGGTACTTAAATCTGGAACTTGCG
AGTGAGCCAG
GenBank Accession HG969038 [GenBank]
Graphic View Graphic view of gene At5g03740
Predicted Position of Insertion Chr5:983459 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F17C15
Hit Gene Code At5g03740 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation histone deacetylase 2C
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX547768 [GenBank]


Last Updated on 07.07.2016 14:03