SimpleSearch - Line and FST details


Line specific information

 
Line ID 548B11
Vector Used pAC161
Line Availability only available from NASC (N452535)
Segregation Analysis 50:32:21
Confirmed for Hit At1g51640
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g51640

 
Sequence (A. th genome BLAST matches underlined)
>82-K020587-022-548-B11-8409
GAGATGATTGTTCATCATAAAGATGCAAGAAAGAGCGGTTTCTTTGTTGGAACTTGACCA
TGCGTCCAAGTTCAAAGCAATCTCTCTCAGTATGTTGTAGATGTGACCTGTGAGAAGCTC
TTCTTGATACTTTGCGTTCTTCCATCCCAAATCAATTTCTATGGGATCCTCCCTATAGTG
AGAACTATGGGATCCACCCTTTACCGATTTTTTTTCAATTCAAAAATGTAAATGTCCGCA
CCGTTATTATAAACCAGCTATGGGATCCTCCCTATAGAGAGAGCTCTGGGACCCCCCCCA
TAGG
GenBank Accession BX547797 [GenBank]
Graphic View Graphic view of gene At1g51640
Predicted Position of Insertion Chr1:19150442 - go to primer design
BLAST e Value 9e-84
Hit Clone Code (BAC ID) F19C24
Hit Gene Code At1g51640 [TAIR] [MIPS] [SIGnAL]
Gene Annotation exocyst subunit exo70 family protein G2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23