SimpleSearch - Line and FST details


Line specific information

 
Line ID 550G09
Vector Used pAC161
Line Availability only available from NASC (N452785)
Segregation Analysis 50:16:14
Confirmed for Hit At1g79560
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g43850

 
Sequence (A. th genome BLAST matches underlined)
>71-K020662-022-550-G09-8409
ATCCTGTACTCTAATACTCGTAGGGCTTCTTTCTTCCTAGGCTGGTTTTGTAAGGTTTGA
GACCTACCTGCCTTAGGTACCCCCACACTCCTACGGTGTCTATGGGATCCTCCCTATAGT
GAGAGCTATGGNATCCTCCCTTTAGCGATTTTTTTTCAATTCAGGAATCTACGGGACCCC
CCCG
GenBank Accession FR812115 [GenBank]
Graphic View Graphic view of gene At5g43850
Predicted Position of Insertion Chr5:17628231 - go to primer design
BLAST e Value 3e-22
Hit Clone Code (BAC ID) MQD19
Hit Gene Code At5g43850 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation RmlC-like cupins superfamily protein
Insertion Classification CDSi
Confirmation Status unknown
Other FSTs Supporting this Hit FR812115 [GenBank]

Gene hit At1g79560

 
Sequence (A. th genome BLAST matches underlined)
>71-K020728-022-550-G09-8409
CACAAGGCTCTCTTTCTTCATATGCTGGCTTTTGTAGAGTTTGAGTGAGACCTTCTTTAG
ATATCCCGAAACTCCAACAGTGTCTATGGCACCCTCCCTTAGAATGAGACAATGGGCATA
CCATTTGTGTTTGCATCTGGTGCGGAGTTCACAGACAGTGAAAAAAGTGGTGCTGCAAAG
ATCAATGAGATGTTTTCAATCGCGAGACGAAATGTAAGGTTCTTAGTTATGTGTTTTAAA
GCTCATACGGTATAGTTGTCTTCTACTCACACTATTATTGTGGATCTAATTTTATATACT
ATCTCCAGGCCCCTGCTTTTGTGTTTGTGGATGAAATAGATGCTATTGCTGGAAAAGATA
CCCATTTAACCTTCAAATTGGTCGGAAATTATGCCAAAATATACACTCATATACTTAAAT
ACTGACAGTTTGAGCTACCAATTCAGTGTAGCCCACTATAGGGAGGATCCCATAGCCTCA
CTATA
GenBank Accession BX572460 [GenBank]
Graphic View Graphic view of gene At1g79560
Predicted Position of Insertion Chr1:29929657 - go to primer design
BLAST e Value 1e-129
Hit Clone Code (BAC ID) T8K14
Hit Gene Code At1g79560 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation FTSH protease 12
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit FR812114 [GenBank] FR812114 [GenBank] BX572461 [GenBank]


Last Updated on 31.08.2016 09:40