SimpleSearch - Line and FST details


Line specific information

 
Line ID 553B01
Vector Used pAC161
Line Availability available as T3 set from NASC (N453005)
Segregation Analysis 50:46:43
Confirmed for Hit At1g12890
Parent of DUPLO pair none
Parent of pair(s) 3451, 9747

Gene hit At1g12890

 
Sequence (A. th genome BLAST matches underlined) 
>02-K023213-022-553-B01-8409
ATTGAATATGTCACTGATAGGTAGAATGTGAGAAAGTGTTATTGAGATTGGTAGAACACT
CCTTGTTTTTGAGAAAAACATTAAGAGATAGGATCAGCAACAAAATGGATTGTTTTCAAA
AGGCTGATCTTGAAGAAGACAGAGACTATAAGATCCCCCCGTCATATGAGGCTCCAAAGA
CTGTTGTGGATGTCTTTCTAAAGAGGTGTTTTCAGTGTACAAAAAGTTTGCTGTA
GenBank Accession BX891573 [GenBank]
Graphic View Graphic view of gene At1g12890
Predicted Position of Insertion Chr1:4392160 - go to primer design
BLAST e Value 4e-80
Hit Clone Code (BAC ID) F13K23
Hit Gene Code At1g12890 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Integrase-type DNA-binding superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37