SimpleSearch - Line and FST details


Line specific information

 
Line ID 554C06
Vector Used pAC161
Line Availability only available from NASC (N453118)
Segregation Analysis 50:50:46
Confirmed for Hit At3g49690
Parent of DUPLO pair none
Parent of pair(s) none
Note Although the line exists, the insertion in At3g27080 can not be ordered because the confirmation of this insertion failed.

Gene hit At3g27080

 
Sequence (A. th genome BLAST matches underlined)
>43-K021826-022-554-C06-8409
GGAAGACTATTGCACACGCAAGATCGNTCAAAGAAATTTCTCACGAGTCTTTTTCCTATG
GGATCCTCCCTATAGTGAGTCGTATTACTCACGGGTTTACATGGAATTGGAGCCCCACTG
GCCTCCCCGCCATAGTGGGACCCTTGGATCCCCCCTCTTCGGGGTTGTGCTGAATACCGG
CTCCACAGGGGCACGCAGAATCTTACAAACAAGGCTTAGGCTCACAACCAATGGGTCGCG
TTGAAGCTCCAGCACCGCCGAGCTCAAAGGTTCTCTCTTTTTTATTTATGTTCATTCTCA
TCATCACATTTCATTTTCATTGCTTGATGTAATCGACTTGTAGATAATATAAGAAGATGT
GTTTGAACCTCATGATCATATTTTGATGTATTGTTCCAAACACAGGCAGTGAAGAATAAG
AAAAGTAGTGATGCCAAGTATGATGCTATGGGTTGGGTGATTC
GenBank Accession BX650929 [GenBank]
Graphic View Graphic view of gene At3g27080
Predicted Position of Insertion Chr3:9985719 - go to primer design
BLAST e Value 1e-156
Hit Clone Code (BAC ID) MOJ10
Hit Gene Code At3g27080 [TAIR] [MIPS] [SIGnAL]
Gene Annotation translocase of outer membrane 20 kDa subunit 3
Insertion Classification CDSi
Confirmation Status failed, line belongs to a contamination group, please check line 592B03

Gene hit At3g49690

 
Sequence (A. th genome BLAST matches underlined)
>43-K022078-022-554-C06-8409
AGATATGGAAGACTATTGCACACGCAAGATCGGGATAGACATTTCTACATGAGATTTTTT
CCTATGGGATCCTCCCTATAGTGAGANNNNNGANTNNCNNNTTTTNTTNCNNCTTTCCTA
CTTTTTGACNTCTTTTCTTACNNCGACTTTTTGAAATCTCCCCCTCCANCTATTATATAA
TCTCCTTTTTTCTTTTCTGCATTCACATAATATTTCCCCTATATANTTTACACAACATCA
TACCCACCAACATATATAATCTTGATCATANANANATAAACAAANGCCGCTATCAAAAAC
AAAACTAANAACAAAACTTCACTATGGGATCCTCCCTATAGTGAGANNAAACANNNNNNN
NNAATACCAATANAATTACAACCTCAAATCATAATTCTCAAACCACAATATTAGAGATAC
ATGCAAACAATACTAATTTCCACATA
GenBank Accession BX650931 [GenBank]
Graphic View Graphic view of gene At3g49690
Predicted Position of Insertion Chr3:18427633 - go to primer design
BLAST e Value 6e-82
Hit Clone Code (BAC ID) T9C5
Hit Gene Code At3g49690 [TAIR] [MIPS] [SIGnAL]
Gene Annotation myb domain protein 84
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23