SimpleSearch - Line and FST details


Line specific information

 
Line ID 554C06
Vector Used pAC161
Line Availability only available from NASC (N453118)
Segregation Analysis 50:50:46
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g27080

 
Sequence (A. th genome BLAST matches underlined)
>43-K021826-022-554-C06-8409
GGAAGACTATTGCACACGCAAGATCGNTCAAAGAAATTTCTCACGAGTCTTTTTCCTATG
GGATCCTCCCTATAGTGAGTCGTATTACTCACGGGTTTACATGGAATTGGAGCCCCACTG
GCCTCCCCGCCATAGTGGGACCCTTGGATCCCCCCTCTTCGGGGTTGTGCTGAATACCGG
CTCCACAGGGGCACGCAGAATCTTACAAACAAGGCTTAGGCTCACAACCAATGGGTCGCG
TTGAAGCTCCAGCACCGCCGAGCTCAAAGGTTCTCTCTTTTTTATTTATGTTCATTCTCA
TCATCACATTTCATTTTCATTGCTTGATGTAATCGACTTGTAGATAATATAAGAAGATGT
GTTTGAACCTCATGATCATATTTTGATGTATTGTTCCAAACACAGGCAGTGAAGAATAAG
AAAAGTAGTGATGCCAAGTATGATGCTATGGGTTGGGTGATTC
GenBank Accession BX650929 [GenBank]
Graphic View Graphic view of gene At3g27080
Predicted Position of Insertion Chr3:9985719 - go to primer design
BLAST e Value 1e-156
Hit Clone Code (BAC ID) MOJ10
Hit Gene Code At3g27080 [TAIR] [MIPS] [SIGnAL]
Gene Annotation translocase of outer membrane 20 kDa subunit 3
Insertion Classification CDSi
Confirmation Status unknown

Gene hit At3g49690

 
Sequence (A. th genome BLAST matches underlined)
>43-K022078-022-554-C06-8409
AGATATGGAAGACTATTGCACACGCAAGATCGGGATAGACATTTCTACATGAGATTTTTT
CCTATGGGATCCTCCCTATAGTGAGANNNNNGANTNNCNNNTTTTNTTNCNNCTTTCCTA
CTTTTTGACNTCTTTTCTTACNNCGACTTTTTGAAATCTCCCCCTCCANCTATTATATAA
TCTCCTTTTTTCTTTTCTGCATTCACATAATATTTCCCCTATATANTTTACACAACATCA
TACCCACCAACATATATAATCTTGATCATANANANATAAACAAANGCCGCTATCAAAAAC
AAAACTAANAACAAAACTTCACTATGGGATCCTCCCTATAGTGAGANNAAACANNNNNNN
NNAATACCAATANAATTACAACCTCAAATCATAATTCTCAAACCACAATATTAGAGATAC
ATGCAAACAATACTAATTTCCACATA
GenBank Accession BX650931 [GenBank]
Graphic View Graphic view of gene At3g49690
Predicted Position of Insertion Chr3:18427633 - go to primer design
BLAST e Value 6e-82
Hit Clone Code (BAC ID) T9C5
Hit Gene Code At3g49690 [TAIR] [MIPS] [SIGnAL]
Gene Annotation myb domain protein 84
Insertion Classification Promoter
Confirmation Status unknown


Last Updated on 14.10.2014 10:23