SimpleSearch - Line and FST details


Line specific information

 
Line ID 554G12
Vector Used pAC161
Line Availability only available from NASC (N453172)
Segregation Analysis 50:26:12
Confirmed for Hit At2g21710
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g38660

 
Sequence (A. th genome BLAST matches underlined)
>95-K021828-022-554-G12-8409
ACCCAAAATCTTAAGAGAAATTATTACGAAACCCATTAGCACGTACTAACAGTTTTGATT
TTTCTAAGCCAAAGCAACGCAGCAATTGTGGAACTTAAAAAATGGATAATATTATAATCA
GTAGGTAATTACCTATGGGATCCTCCGAA
GenBank Accession BX651056 [GenBank]
Graphic View Graphic view of gene At4g38660
Predicted Position of Insertion Chr4:18066846 - go to primer design
BLAST e Value 3e-47
Hit Clone Code (BAC ID) F20M13
Hit Gene Code At4g38660 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Pathogenesis-related thaumatin superfamily protein
Insertion Classification CDSi
Confirmation Status unknown

Gene hit At2g21710

 
Sequence (A. th genome BLAST matches underlined)
>95-K022078-022-554-G12-8409
ATGNAGCCATTTACAATTGAATATATCCTGTTATCTATGTGATATTCTCAGCCTTATTAA
CCTACTGAAAAAACCTTATCGGCTTATACCTAAACGTTAACCCCCAACCTTTGGTTTTCC
TAAAACTAGGGGACCCCCCCAAAACTCAGGCTTCTCTCCACTTTATCTCTCACTCTCCTC
TCAAACTCTTCATCCGTACAAGCCAACATGTATCTGAGCTTGAAGTTAACTCTGTTCTCA
ACCATAATGGTGTGCCTTGGGATTATCCGACGCCCTATGGGATCCTCCCTATAGTGAG
GenBank Accession BX651057 [GenBank]
Graphic View Graphic view of gene At2g21710
Predicted Position of Insertion Chr2:9273299 - go to primer design
BLAST e Value 2e-63
Hit Clone Code (BAC ID) F2G1
Hit Gene Code At2g21710 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Mitochondrial transcription termination factor family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX651058 [GenBank]


Last Updated on 07.07.2016 14:03