SimpleSearch - Line and FST details


Line specific information

 
Line ID 556C10
Vector Used pAC161
Line Availability only available from NASC (N453314)
Segregation Analysis 50:19:16
Confirmed for Hit At5g61380
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g61380

 
Sequence (A. th genome BLAST matches underlined)
>75-K025925-022-556-C10-8409
TCTTGCGACCATGAGAGCCTCCCTATAGTGAGACCTAGTTAGGAGAGCTTTTATGTAAGG
ACACATTATAATGGGTGAGTATCCCATGGGGGGGGGGGGGGGGTTAGAAATTTATATTTT
AAATTACCCCACAGTTTCTTTCTGTTTTCAAAAAAATTAAAAATCATTATACAAATGCCG
TACTAAATAGAATCCTCCGTATACTTTTGAGTANCGGACCGCATCAGACCCCGCCATCTA
AAACTACATTTTAGGATTCCGCTTCGTATCGTTGATTAAAACATATTTATAACGATACTA
TCATCGGGGGGGCGGGGGGTATATTTTTCTATTTTCCTTACCCTGGGTAAAAAGCATTAT
ATATGCTTATACGAA
GenBank Accession FR812248 [GenBank]
Graphic View Graphic view of gene At5g61380
Predicted Position of Insertion Chr5:24674976 - go to primer design
BLAST e Value 6e-08
Hit Clone Code (BAC ID) MFB13
Hit Gene Code At5g61380 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation CCT motif -containing response regulator protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit FR812248 [GenBank]


Last Updated on 31.08.2016 09:40