SimpleSearch - Line and FST details


Line specific information

 
Line ID 557E02
Vector Used pAC161
Line Availability only available from NASC (N453426)
Segregation Analysis 50:4:4
Confirmed for Hit At2g02720
Parent of DUPLO pair none
Parent of pair(s) 6534, 6540, 6555, 6557, 85699, 85797, 85828, 85834, 85849, 85852, 85856, 85860, 85867, 85869

Gene hit At2g02720

 
Sequence (A. th genome BLAST matches underlined)
>13-K023923-022-557-E02-8409
CGATCTATGTATGCACTGAGCCGTCCGACAACGATCTACTAAAACCAAAACCAGGGACTA
TAAGGCACGCCGTGACAAGGGACCGACCACTCTGGATCATCTTTGCGAGAAGCATGATCA
TAAAACTGCAACAAGAACTGATCATAACGAATGATAAAACAATCGACGGTCGGGGAGCGA
AAATTTATATCACTGGGGGTGCAGGTTTAACGTTGCAGTTCGTCAGGAATGTGATAATAC
ATAATATTCATATCAAACAGATTAAAAGGGGAGCTGGTGGGTTGATTATAGACTCCGAGC
AACATTTTGGGCTTCGGACAGTGAGTGATGGCGATGGGATTAATATTTTTGGAGCAACGA
ATGTTTGGATCGATCATGTCTCAATGACGGATTGTTCTGATGCGATGATTGGGGCGATCA
TGGAGATCGACTGCAACTGCACTCTCCAATTCCCATTTTAAATACCACGACGA
GenBank Accession BX891675 [GenBank]
Graphic View Graphic view of gene At2g02720
Predicted Position of Insertion Chr2:763684 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T20F6
Hit Gene Code At2g02720 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Pectate lyase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03