SimpleSearch - Line and FST details


Line specific information

 
Line ID 557F12
Vector Used pAC161
Line Availability only available from NASC (N453448)
Segregation Analysis 50:5:5
Confirmed for Hit At3g20880
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g20880

 
Sequence (A. th genome BLAST matches underlined)
>94-K023923-022-557-F12-8409
ATTGAAGGACCGTGATGGTCATCATCATGGTCAGAAGTCATTGGTGACCCTCTTGGTGGT
CGGTGGAATCAAGGACCACATCGCTGCTGCTGCTTCCACCATCACCGAGGTTTGGTAACC
CTATGGGATCCTCCCTATAGTGAGTCTCATATACTGATGGGTCCAACCCAGTTCTCTTGT
CCTCTATGCTTCAAGACTTTCAACAGATACAACAACATGCAAGTAAGGATATATTCATTC
AATAAACCTAACTCTAATTAGTTGCTATTTTCCATAAAATGATTTTCTAGTTTTGACTTT
TTGTTCTTGAAAATACATTAGTTTTCTTATTTGTATCTAGGTCCTAATTCTAGGTATTTA
TTTATTTTTCCGGTGTTCCTCATGATAACAGATCCAAGGTACCCCTTCTAAAGGGAGTGA
GATTATGCGAAAATATACCCTCATATATATAAATACTGACAGTTTGACCTACCAAGTCAG
GGTACCCCAT
GenBank Accession BX891699 [GenBank]
Graphic View Graphic view of gene At3g20880
Predicted Position of Insertion Chr3:7315173 - go to primer design
BLAST e Value 1e-98
Hit Clone Code (BAC ID) MOE17
Hit Gene Code At3g20880 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation WIP domain protein 4
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX891700 [GenBank]


Last Updated on 07.07.2016 14:03