SimpleSearch - Line and FST details


Line specific information

 
Line ID 559C07
Vector Used pAC161
Line Availability only available from NASC (N453599)
Segregation Analysis 50:39:35
Confirmed for Hit At1g55580
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g55580

 
Sequence (A. th genome BLAST matches underlined)
>51-K021639-022-559-C07-8409
AACCATTTACATTGAATAACATGCAATATACCTTCAGGTAAAGGAAAATAATATTTATTA
TTGCCATTGAAAAAGACTCATTTGAGCCATAGAGAAAAAGAATCATTTGAACCAGAAGCA
TCTTTTTCTATCTTTTCAAATGCTTACTTCCTTCAAATCCTCTATGGGATCCTCCCTATA
GTAAGTCGTATTACTCACGGGGTCCCCCGTATTTGGGGCCCCCCTGGGTTCGCCGCTCTG
TGGGGTCCTCGGGGTCCTGCTCTTTAGACGGGGTGGTGCGTTGTGGGGTCCTTGTGGGGG
TGGCCGCTTTGGGGCGCGCTCGTGTTGGTGCTCTGGGGGGCCC
GenBank Accession BX651365 [GenBank]
Graphic View Graphic view of gene At1g55580
Predicted Position of Insertion Chr1:20763989 - go to primer design
BLAST e Value 3e-65
Hit Clone Code (BAC ID) T5A14
Hit Gene Code At1g55580 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation GRAS family transcription factor
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX651367 [GenBank]


Last Updated on 07.07.2016 14:03