SimpleSearch - Line and FST details


Line specific information

 
Line ID 559H02
Vector Used pAC161
Line Availability only available from NASC (N453654)
Segregation Analysis 50:40:31
Confirmed for Hit At2g45180
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g45180

 
Sequence (A. th genome BLAST matches underlined)
>16-K021639-022-559-H02-8409
AGCCATTTACATTGAATATATCCTGAGCATATACTGTGGATCTGTTTGAACCATTAATTA
TGCACCCCGTACTATCTTGAGACTTTACACTTGAAATATCCCAATTAGAATATCTGATTA
CAACCATGATTGCTGAATCCTATGGGATCCTCCCTACACTGAGTCATATTACTCAAACCT
ATGGGATCCTCCCTATCCTGAGTCATATTACTCACCGGACCCATCCAACCGTAGCTCACC
AAAGAGATTTTTCTCTTTTAAAGTCTCAAATCTTCAAGAACATTGGAAACCATGAGGAAC
TTTCTTGCCACAATAGTTCAACAGCAAGGTTAGATCAATAGGAACATTGAGATTAATCCC
CAAGACATTGGCTTTAAGAGCGGTGCAGAGACAAACCGCAGCTTCAAGATTAGCAAGACC
TTGAAGAAGTGTACAACAAGGAGTCTTTGGTGGAGAACCAACAACAACGTTAACTATGGG
ATCCTCCCTATAGTGAGTCGTATTACTC
GenBank Accession BX651465 [GenBank]
Graphic View Graphic view of gene At2g45180
Predicted Position of Insertion Chr2:18627026 - go to primer design
BLAST e Value 1e-132
Hit Clone Code (BAC ID) F4L23
Hit Gene Code At2g45180 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Other FSTs Supporting this Hit BX651466 [GenBank]

Gene hit At1g02730

 
Sequence (A. th genome BLAST matches underlined)
>16-K021750-022-559-H02-8409
AGCCATTTACAATTGGATATATCCTGAGCATATACAGTGGATACTTTTGAACCATTAATT
AACAACAAAGTAAGAAATTGAGACTTTACTTTGAAAAATCGTAATTATAATATCTGATTA
CAAACATGAAGGCTGAAGCCTATGGGATCCTCCCTATAGTGAGNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
GenBank Accession BX651467 [GenBank]
Graphic View Graphic view of gene At1g02730
Predicted Position of Insertion Chr1:594528 - go to primer design
BLAST e Value 2e-47
Hit Clone Code (BAC ID) T14P4
Hit Gene Code At1g02730 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation cellulose synthase-like D5
Insertion Classification TS2TE (3')
Confirmation Status unknown


Last Updated on 31.08.2016 09:40