SimpleSearch - Line and FST details


Line specific information

 
Line ID 560F05
Vector Used pAC161
Line Availability only available from NASC (N453729)
Segregation Analysis 50:49:45
Confirmed for Hit At2g41130
Parent of DUPLO pair 12768
Parent of pair(s) none

Gene hit At2g41130

 
Sequence (A. th genome BLAST matches underlined)
>38-K021730-022-560-F05-8409
AGTCCTCTATGGGATCCTCCCTATAGTGAGACATACAAACATCAGATTTCAACCTTCTTG
ATCCAAACTTTTCATTGTAATTTCATGTTTCTATTTTCAAACCCATAAAGCCACCCCTGC
TCGCCAAAGTAATTCAACGATTCATAGAACTTAACATCAAACCCTATGGGATCCTCCCTA
TAGTGAG
GenBank Accession BX651519 [GenBank]
Graphic View Graphic view of gene At2g41130
Predicted Position of Insertion Chr2:17144128 - go to primer design
BLAST e Value 3e-37
Hit Clone Code (BAC ID) T3K9
Hit Gene Code At2g41130 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation basic helix-loop-helix (bHLH) DNA-binding superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03