SimpleSearch - Line and FST details


Line specific information

 
Line ID 561F07
Vector Used pAC161
Line Availability only available from NASC (N453827)
Segregation Analysis 100:86:79
Confirmed for Hit At1g18860
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g18860

 
Sequence (A. th genome BLAST matches underlined)
>54-K021688-022-561-F07-8409
TTTACATTTAGAATATAATTATCAGTTCACTTAGGACATGTAGATTTACCTGTTTTCCTA
CTGGACAAGAAGCTGCCATGGTGCCACGATAGTAAGCTCGGGGACATGGATTGCCTTTAG
CTATTTTCTGGCCATATTTCCTCCATTGACATCCGTCCTTCATCTACCGAGACAATATAT
AGCCCAAGAAATTAAAACACAAACTTTGATTCTGTTCTTGTGGAATATACTCTTTGAGAA
GTTTTTTTTTCTTATAAAAATAAAAGTGAGAAAAAAGGAAGGATTATACTGTTAACATTC
ATAGATGTATATACTATTTAAATTAAAGATATGAATAAAATGTACTAACCGTTGGTGTCC
CGCGTCTGGATCTCACCGAAACCCTCTGGGATCCTCCCTATACTGAGAAAAAGGAACAAA
CC
GenBank Accession BX651577 [GenBank]
Graphic View Graphic view of gene At1g18860
Predicted Position of Insertion Chr1:6510378 - go to primer design
BLAST e Value 8e-149
Hit Clone Code (BAC ID) F6A14
Hit Gene Code At1g18860 [TAIR] [MIPS] [SIGnAL]
Gene Annotation WRKY DNA-binding protein 61
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23