SimpleSearch - Line and FST details


Line specific information

 
Line ID 563G04
Vector Used pAC161
Line Availability only available from NASC (N454028)
Segregation Analysis 50:40:23
Confirmed for Hit At5g47640
Parent of DUPLO pair none
Parent of pair(s) 95956, 95957, 95959

Gene hit At5g47640

 
Sequence (A. th genome BLAST matches underlined)
>31-K022587-022-563-G04-8409
ATTTACATTGAAGCCATTGCTGAGCCATTGAAAGTTTACTTGCAGAGGTTTAGGGAGATC
GAAGGGGAGAGGACTGGACTATGGGATCCTCCCTATAGTGAGTCGTATTACTCACGGGGC
CCCCCCGAATTGGGGCCCCACTGGGCTCCCCCCCCTGGGGGGCCCCGGGGCCCCCGCCCC
CCGGGGGCCCCGGGGGCCCCGGGGCCCCGGGGGCCCGGGGCCCCCGGGGGCCCCGGCGGC
CCCGGGGCCCCGGGGGCCCCGGGCCCCCCGGGCCCCCGGGCCCCCGGGCCCCCCGGGGCC
CCGCGGGCCCGGGGGCCCCGGGGCCCGCGGGCCCCCCCGGTACGGGGGCCCCCGCGCCCG
GCGGGAGCGCCCGGGCG
GenBank Accession BX651828 [GenBank]
Graphic View Graphic view of gene At5g47640
Predicted Position of Insertion Chr5:19309725 - go to primer design
BLAST e Value 2e-26
Hit Clone Code (BAC ID) MNJ7
Hit Gene Code At5g47640 [TAIR] [MIPS] [SIGnAL]
Gene Annotation nuclear factor Y, subunit B2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX651827 [GenBank]


Last Updated on 14.10.2014 10:23