SimpleSearch - Line and FST details


Line specific information

 
Line ID 564B07
Vector Used pAC161
Line Availability only available from NASC (N454067)
Segregation Analysis 50:34:20
Confirmed for Hit At1g06680
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g06680

 
Sequence (A. th genome BLAST matches underlined)
>50-K021119-022-564-B07-8409
AGCCATTTACATTGAATATATCTGGACATCAACAGAGAGATCCTCCAATATCCGAAACCA
ACCAATCAGCTTCACTCTTGGTTTCACCTCCATACATTAACACACCAACAATCCTCAAAA
AACACTTTCATAACTTAATCACACACAAGGAGAGAAGAGAGAAAGAGAGAAAGAGAGACA
GAGATAATGGCGTACAGTGCGTGTTTCCTACACCAGAGCGCATTGGCTTCATCAGCCGCA
CGATCATCATCTTCCTCCTCATCCCAGCGTCACGTGTCGCTCTCCAAACCTGTTCAGATC
ATCTGTAAAGCTCAACAGTCTCATGAAGACGATAACTCCGCCGTCTCCCGCCGTCTTGCT
CTCACTCTCCTCGTCGGCGCCGCTGCTGTTGGTTCCAAAGTATCTCCTGCTGATGCCGCC
TACGGTGAAGCTGGTGCGTTTATAAGAAAGACTAACCTTGGATCATTTCATTTTCGTCAA
CAAGAATC
GenBank Accession BX651872 [GenBank]
Graphic View Graphic view of gene At1g06680
Predicted Position of Insertion Chr1:2047779 - go to primer design
BLAST e Value 9e-155
Hit Clone Code (BAC ID) F12K11
Hit Gene Code At1g06680 [TAIR] [MIPS] [SIGnAL]
Gene Annotation photosystem II subunit P-1
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23