SimpleSearch - Line and FST details


Line specific information

 
Line ID 565B11
Vector Used pAC161
Line Availability only available from NASC (N454167)
Segregation Analysis 50:39:36
Confirmed for Hit At3g09960
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g09960

 
Sequence (A. th genome BLAST matches underlined)
>82-K023155-022-565-B11-8409
TGATATATCCTGGCCATCTACTTTNTGATCTTATGGCGTTCCTCATGGATCTTCTGGTGA
CATTCTCCATTGATTCTTCTTTCTGGTTATAGTTTATGATTAAACAGTTTGTAATTGTAA
AATATAGTAAAAAANAATAATGAGTGGAAAATGGGAATAGAAGATANATGAGGAAAGTGA
TAAGATTGGGGAGTAGATGGNNAGGATATATTNAATTGTAAATGGGTTAATGGAAGGGAA
ATGTAAATGGATAAGAAATGAGTATGATGGAAAGAATAAAAAAAAAGAAAGTTATTTAAG
AAGTGTTTTAAAGGTAAAAAAT
GenBank Accession FR812373 [GenBank]
Graphic View Graphic view of gene At3g09960
Predicted Position of Insertion Chr3:3062476 - go to primer design
BLAST e Value 8e-35
Hit Clone Code (BAC ID) F8A24
Hit Gene Code At3g09960 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Calcineurin-like metallo-phosphoesterase superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX651940 [GenBank] FR812373 [GenBank]


Last Updated on 31.08.2016 09:40