SimpleSearch - Line and FST details


Line specific information

 
Line ID 565F11
Vector Used pAC161
Line Availability only available from NASC (N454215)
Segregation Analysis 50:47:45
Confirmed for Hit At2g01320 At2g35605
Parent of DUPLO pair 2502
Parent of pair(s) none

Gene hit At2g01320

 
Sequence (A. th genome BLAST matches underlined)
>86-K021209-022-565-F11-8409
TATAACCCACGATTGTTTCTGGCTCCTGAGGGAATGGTGTTTTGGAAGGACAGACAGCTC
TGTCCAAAACCCTATGGGATCCTCCCTATCCTGAGACGGACATCGCTCTCTTACCTGAAG
ACAAAGCTGAAGATGATTACGCTGATACCGAATACGGTGGTGGTGATTCCATTCTTCCGG
TGACAATCCGTTGGAGGAACATCACCTGCTCGCTCTCCGATAAATCCTCCAAATCGGTGA
GCACATTTCTTCTCCTTTTGCATGTTTCGATTGCACCTATATTAGTCTTTCCAATTTCAC
GTTAATAACCGAATCATAATTGGTTGATTATGTGATTCTCAGGTGAGGTTTTTCTTNAAA
AATGTATCCGNAAAANCAAAACCTGNAAGGTTNCNATGGAAACCTCCCCATAGNGAAATA
ATAATAAATTATTA
GenBank Accession BX652002 [GenBank]
Graphic View Graphic view of gene At2g01320
Predicted Position of Insertion Chr2:158083 - go to primer design
BLAST e Value 1e-123
Hit Clone Code (BAC ID) F10A8
Hit Gene Code At2g01320 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ABC-2 type transporter family protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At2g35605

 
Sequence (A. th genome BLAST matches underlined)
>86-K022811-022-565-F11-8409
GCCAGTACCTTGATCTACCAGTTTTAGCGCCGGTGGAAGAAGCGGCCTTCGCCATCACTA
CCCTGCAAGCTCCGAAAACCCTCGACATTTTTTCTTCTTCCACAGTTTTGAAATTGGAAG
GAGAGAGAGCTCTGTCTAAAACCCTATGGGATCCTCCCTATAGTGAGTCGTATTACTCAC
CGGATCCTCCTGATTGGGGGGTCCACGGGGTAGCCA
GenBank Accession BX652003 [GenBank]
Graphic View Graphic view of gene At2g35605
Predicted Position of Insertion Chr2:14946247 - go to primer design
BLAST e Value 8e-66
Hit Clone Code (BAC ID) T20F21
Hit Gene Code At2g35605 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation SWIB/MDM2 domain superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX891828 [GenBank] BX891829 [GenBank]


Last Updated on 31.08.2016 09:40