SimpleSearch - Line and FST details


Line specific information

 
Line ID 567F02
Vector Used pGABI1
Line Availability only available from NASC (N454398)
Segregation Analysis 44:39:33
Confirmed for Hit At2g37080
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g37080

 
Sequence (A. th genome BLAST matches underlined)
>14-K021149-022-567-F02-8409
AGCCATTTACATTGAATATATCCTGAACTAGAAGCTGAGCTGAGGAGACTCAAGGTTCAG
TGTGATCAATGGAGGAAAGCAGCTGAAGCCGCAGCTACTATGCTCTCTGGTGGTAACAAC
AACAATAACAGTAACGGGAAGTATGGGATCCTCCCTATAGTGAG
GenBank Accession BX652233 [GenBank]
Graphic View Graphic view of gene At2g37080
Predicted Position of Insertion Chr2:15581843 - go to primer design
BLAST e Value 5e-61
Hit Clone Code (BAC ID) T2N18
Hit Gene Code At2g37080 [TAIR] [MIPS] [SIGnAL]
Gene Annotation ROP interactive partner 3
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX652232 [GenBank]


Last Updated on 14.10.2014 10:23