SimpleSearch - Line and FST details


Line specific information

 
Line ID 567F10
Vector Used pGABI1
Line Availability only available from NASC (N454406)
Segregation Analysis 50:43:37
Confirmed for Hit At1g20980
Parent of DUPLO pair 219
Parent of pair(s) none

Gene hit At3g52110

 
Sequence (A. th genome BLAST matches underlined)
>78-K021149-022-567-F10-8409
ATTGAATAATCCTGCATTGGGATCATAAACGAGCTTATTGGGCCATAACTGATCTGAGTT
CATGCTGCATTGGGTCGGACCAGAGAGTTATCCGCTCCAACAACTTGATAACGGAGTCGG
GTCTCCCAGCAAAAGCTTCTCGGGTAAGCCTCCACTGAAAGTTGAAAATTTATAAGTCCC
ATCTCAGCGCGCGAAAATTCCGAAATTATATAGGGAAAGTCACCGCGACAATCTAAAATT
TTGGACACTCAAAATCCCAAATTAGTCTTGTTGCTTTCATCACCGGAATCACTCAAGCTT
CTTCGATCTCTCTCGCGTCGTTTCGTTTCCAAATGTGAGTTTTCTTCTATTCATTTTTTC
GTTAAAGTTGTTACACAGATCTCAAAACTAGATCGAATTGTACGAAATCGAAATTTATTG
TAATGTTTAGGTAGGAGAAAACCCAGTTATTGAATCGTTGAATTGAATCCATTTACGTTT
TCTGATTACAGCTTGAAGATGGGAGAT
GenBank Accession BX652243 [GenBank]
Graphic View Graphic view of gene At3g52110
Predicted Position of Insertion Chr3:19325859 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F4F15
Hit Gene Code At3g52110 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation unknown protein
Insertion Classification Promoter
Confirmation Status unknown

Gene hit At1g20980

 
Sequence (A. th genome BLAST matches underlined)
>78-K021133-022-567-F10-8409
CCGGAATGAACCATTTACATTGAATATATCCTGATGAAAGATCCATCATAATTAATGATA
ACTTAGTCTTCTCGCTGTCTTTGTTACCAAACCCACCTTGAGATAATATCGCTAGTGCAT
CAGGTGAAGATGAACCTAATGTCGTCGAAAGAACAGCAAGCAAGTCCATGGTAGAAGGAG
AAGCCCCATTCATATCATTTTGTGGGTTCACCGTCGGGTGATCCATATTTTTCCTGGCTA
AACTTCCAATATTGTTCAACTTAGAGACAAGATCCATAGGCAAAGGCAATGCATTTATCT
TGTTAAGTATCTGAAGAAGCTGCTCTCTATCAGGCACAGCTGGAGATCCCACTGGGGGCT
TTACCGCATTCTTACCTGCAGATCACACACAACAAAATCTGTTAATAAAACAAGAACATC
AAAGCAGAGTTCCCAGACTAAAATACTTCTACAAGTCGCAAAACTAGTGTATGGGATCCT
CCCTATAGTGAG
GenBank Accession BX652242 [GenBank]
Graphic View Graphic view of gene At1g20980
Predicted Position of Insertion Chr1:7326262 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F9H16
Hit Gene Code At1g20980 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation squamosa promoter binding protein-like 14
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03