SimpleSearch - Line and FST details


Line specific information

 
Line ID 569H01
Vector Used pAC161
Line Availability only available from NASC (N454613)
Segregation Analysis 50:48:37
Confirmed for Hit At1g01480
Parent of DUPLO pair none
Parent of pair(s) 4574, 4630, 58488, 92309, 92310, 92311, 92312, 92313

Gene hit At1g01480

 
Sequence (A. th genome BLAST matches underlined)
>08-K021257-022-569-H01-8409
GNAGCCATTTACAATTGAATATCTCGACAATTTCAAATTAACCGTTGACGCCGCGGAATG
GGCTTATAAAAAAGCCCAAGAGTCCAATAAAAAAGTCAAAGGTCTGATTTTGACCAACCC
ATCAAATCCACTCGGTACAATGTTGGATAAGGACACACTCACGAACTTGGTCCGGTTTGT
CACGAGGAAGAACATTCACCTATGGGATCCTCCCTATAGTGAGACTATGGGATCCTCCCT
ATAATGCGGTACTATGAATTATCCATTATCATATACTATTACTATTTTCTCTTAACAAAG
GGATCCTGCATTTTGAGAAAACGACCAATTACGATCCGTCGTATTTAAAGGCGAAAGCAA
TAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTACATTCACGTCCGAAT
GGGGGCTTACATGAGAAACTTCACGATCGATGCCTTGATTTCGCCATTCCCAGATACCCA
TTTCATCTTCGGATTGGTCTGAGATTATGCGAAAATATA
GenBank Accession BX652468 [GenBank]
Graphic View Graphic view of gene At1g01480
Predicted Position of Insertion Chr1:177088 - go to primer design
BLAST e Value 3e-96
Hit Clone Code (BAC ID) F22L4
Hit Gene Code At1g01480 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation 1-amino-cyclopropane-1-carboxylate synthase 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX572586 [GenBank] BX652468 [GenBank]


Last Updated on 31.08.2016 09:40